ID: 913039445

View in Genome Browser
Species Human (GRCh38)
Location 1:115008369-115008391
Sequence GACAAGAGCTGTCTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039439_913039445 18 Left 913039439 1:115008328-115008350 CCGTAGTCAAATGTTCAGTTTCC 0: 53
1: 132
2: 165
3: 111
4: 311
Right 913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG No data
913039442_913039445 -6 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG No data
913039438_913039445 19 Left 913039438 1:115008327-115008349 CCCGTAGTCAAATGTTCAGTTTC No data
Right 913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG No data
913039441_913039445 -3 Left 913039441 1:115008349-115008371 CCACCAAATCCCAGTAACAGGAC No data
Right 913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039445 Original CRISPR GACAAGAGCTGTCTCTCAAA AGG Intergenic
No off target data available for this crispr