ID: 913039446

View in Genome Browser
Species Human (GRCh38)
Location 1:115008397-115008419
Sequence AGTTATCTACAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039443_913039446 16 Left 913039443 1:115008358-115008380 CCCAGTAACAGGACAAGAGCTGT No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data
913039441_913039446 25 Left 913039441 1:115008349-115008371 CCACCAAATCCCAGTAACAGGAC No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data
913039442_913039446 22 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data
913039444_913039446 15 Left 913039444 1:115008359-115008381 CCAGTAACAGGACAAGAGCTGTC No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039446 Original CRISPR AGTTATCTACAGAAGATAGC AGG Intergenic
No off target data available for this crispr