ID: 913039447

View in Genome Browser
Species Human (GRCh38)
Location 1:115008398-115008420
Sequence GTTATCTACAGAAGATAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039441_913039447 26 Left 913039441 1:115008349-115008371 CCACCAAATCCCAGTAACAGGAC No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data
913039444_913039447 16 Left 913039444 1:115008359-115008381 CCAGTAACAGGACAAGAGCTGTC No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data
913039442_913039447 23 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data
913039443_913039447 17 Left 913039443 1:115008358-115008380 CCCAGTAACAGGACAAGAGCTGT No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039447 Original CRISPR GTTATCTACAGAAGATAGCA GGG Intergenic
No off target data available for this crispr