ID: 913039545

View in Genome Browser
Species Human (GRCh38)
Location 1:115009146-115009168
Sequence CCTGATATGCAGCCATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039545_913039549 11 Left 913039545 1:115009146-115009168 CCAATCAATGGCTGCATATCAGG No data
Right 913039549 1:115009180-115009202 GTGTTAATTTGCTCAAGCAATGG 0: 6
1: 1
2: 10
3: 34
4: 163
913039545_913039550 23 Left 913039545 1:115009146-115009168 CCAATCAATGGCTGCATATCAGG No data
Right 913039550 1:115009192-115009214 TCAAGCAATGGAACCACATCTGG 0: 4
1: 193
2: 209
3: 161
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039545 Original CRISPR CCTGATATGCAGCCATTGAT TGG (reversed) Intergenic
No off target data available for this crispr