ID: 913042867

View in Genome Browser
Species Human (GRCh38)
Location 1:115045480-115045502
Sequence CTAACATCACATATTGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913042863_913042867 -2 Left 913042863 1:115045459-115045481 CCATTTAAGATAAACCCACACCT No data
Right 913042867 1:115045480-115045502 CTAACATCACATATTGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913042867 Original CRISPR CTAACATCACATATTGAACA CGG Intergenic
No off target data available for this crispr