ID: 913045778

View in Genome Browser
Species Human (GRCh38)
Location 1:115072525-115072547
Sequence TATTGCCCCTGGAGTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913045778 Original CRISPR TATTGCCCCTGGAGTAAAGT GGG (reversed) Intronic
904503420 1:30930975-30930997 ATCTGCCCCTGGAGCAAAGTCGG + Intergenic
906325948 1:44845927-44845949 TATTGCCCCAAGAGCAAACTAGG - Intergenic
909725250 1:78827072-78827094 AGTTCCCCCTGGATTAAAGTAGG - Intergenic
910757688 1:90709394-90709416 TATTGTCCCAGGAAGAAAGTTGG - Intergenic
912338015 1:108880950-108880972 TACTGCCAGTGGAGTAAAGCAGG + Intronic
913045778 1:115072525-115072547 TATTGCCCCTGGAGTAAAGTGGG - Intronic
914726887 1:150335401-150335423 TTTTTCCCCTGGAGTAAGGATGG + Intronic
924843752 1:247743981-247744003 TTTTGCACCCGGGGTAAAGTAGG + Intergenic
1065104483 10:22368614-22368636 TTTTGACCCTGGAGTCAAGGAGG + Exonic
1066497367 10:35955266-35955288 TATTGCCCCAGGTGTAGAGGGGG - Intergenic
1068189365 10:53630380-53630402 AGTTGCCCCTGGAGGAAACTTGG + Intergenic
1073468863 10:103710503-103710525 TGTTCCCCCAGGAGTAAAATAGG - Intronic
1078148213 11:8736704-8736726 TGTTGCCCCTGGAATACAGTAGG - Intronic
1079920710 11:26430828-26430850 TAATGCCACTGGAGTCAATTTGG - Intronic
1087169201 11:95033245-95033267 CATTGGCCCTGGAGTGCAGTAGG + Intergenic
1094151076 12:27284221-27284243 TACTACCCCTGCAGCAAAGTTGG - Intronic
1094737378 12:33250094-33250116 TCTTCCCCCTTGAGAAAAGTGGG + Intergenic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1100125574 12:91420819-91420841 TATTGCCCATGGAATTAAATGGG + Intergenic
1101471689 12:105002841-105002863 TTTTGACCATGGAGTAAAGGTGG + Intronic
1102784843 12:115596027-115596049 TATTTCTCCAAGAGTAAAGTGGG - Intergenic
1104538310 12:129639455-129639477 TAAAGCCCTTGGAGTAAAGAAGG - Intronic
1106713186 13:32360218-32360240 TAGTGCAACTGGAGTAGAGTGGG + Intronic
1114480593 14:23031607-23031629 AATTGCCCGTTTAGTAAAGTTGG - Intronic
1116446436 14:45017511-45017533 TTGTAGCCCTGGAGTAAAGTTGG + Intronic
1116607531 14:47020494-47020516 TATTGCTCCTTGAGTGAAGATGG - Intronic
1123506792 15:20949531-20949553 TATTGCACATGTAGTAAAATGGG + Intergenic
1123564017 15:21523276-21523298 TATTGCACATGTAGTAAAATGGG + Intergenic
1123600271 15:21960560-21960582 TATTGCACATGTAGTAAAATGGG + Intergenic
1125739960 15:41955556-41955578 TACTCTCCCTGGAGTAAAGCTGG + Intronic
1125981276 15:44003541-44003563 TATTGTGTTTGGAGTAAAGTAGG - Intronic
1127044540 15:55011795-55011817 CAATGGACCTGGAGTAAAGTGGG + Intergenic
1128839640 15:70839755-70839777 TATAGCCTCTAGAGTAAAGACGG - Intronic
1202972378 15_KI270727v1_random:250371-250393 TATTGCACATGTAGTAAAATGGG + Intergenic
1133337929 16:5018298-5018320 TATTGCACCCAGAGAAAAGTAGG + Exonic
1134846446 16:17444919-17444941 TATGGCACCTGGAGCATAGTAGG + Intronic
1135104345 16:19634543-19634565 TATAGCCCATTGAGTAAAATAGG + Intronic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1140168163 16:72575914-72575936 TATTGTCATTTGAGTAAAGTGGG - Intergenic
1140906784 16:79415875-79415897 TATGGCCCCTGGAGAGAAGAGGG - Intergenic
1141035193 16:80620234-80620256 AATTGCCCCTGGGCAAAAGTTGG - Intronic
1144279219 17:13707993-13708015 GATTGAGCCAGGAGTAAAGTAGG + Intergenic
1147888903 17:43703422-43703444 TATTTCCCCATCAGTAAAGTGGG + Intergenic
1148974719 17:51517067-51517089 TATTGCTGCTGGAAGAAAGTGGG - Intergenic
1151602400 17:75114258-75114280 TGCTGCCCCTGGAGAAAAATTGG + Intronic
1155143753 18:23066690-23066712 TCTTTCCCCTGGATTAGAGTTGG - Intergenic
1156471113 18:37377814-37377836 TGATGCCACTGGAGGAAAGTGGG + Intronic
1161857073 19:6772238-6772260 GCTTGTCCCTGGAGGAAAGTGGG + Intergenic
1163818251 19:19481115-19481137 TTTTCTCCCTGGAGGAAAGTGGG + Intronic
1166503763 19:43359068-43359090 GATTGCCCCAGGAGTCAGGTGGG + Intronic
1166506691 19:43375690-43375712 GATTGCCCCAGGAGTCAGGTGGG - Intergenic
1167664373 19:50815270-50815292 TATGGCCAGTGGAGTACAGTTGG + Intergenic
926305503 2:11635112-11635134 TATTTCCCCTAGAGTAAGGAAGG + Intronic
926849452 2:17178865-17178887 TATTTCCCATGGAGAAAAATTGG + Intergenic
929435378 2:41924869-41924891 TATTGCACCAGTAGTAGAGTGGG + Intergenic
931075401 2:58705769-58705791 TAGTTCCCCAGGATTAAAGTTGG + Intergenic
935167311 2:100580726-100580748 CATTGCCACTGGAGTAGAGGGGG - Intergenic
936625507 2:114144094-114144116 TCTTGCCTCTGGAGAAAACTAGG - Intergenic
939678078 2:145096963-145096985 TATGGCACCTGCAGCAAAGTTGG - Intergenic
940300928 2:152175837-152175859 TCTCGCCCCGGGAGAAAAGTTGG - Exonic
1178403682 21:32308024-32308046 TAATGCCCATGGTGTCAAGTTGG - Intronic
1185085430 22:48738212-48738234 TATTGTCACTGGAGGAAAGGAGG + Intronic
949894026 3:8756025-8756047 TATTGCCCATACAGTAAAGTGGG - Intronic
950934448 3:16824353-16824375 TAATGCCCCTGGAGTGAGGGTGG - Intronic
957725477 3:84060069-84060091 TAATGCCACTGGAGGAAACTAGG - Intergenic
958585158 3:96077678-96077700 TATTGTCCTGGGAGTTAAGTGGG - Intergenic
959436853 3:106325995-106326017 TATTTCACCAGGAATAAAGTTGG - Intergenic
960623981 3:119662368-119662390 TATCGCCCCTGAAGTACAGGCGG + Intronic
964920896 3:161893947-161893969 TATTTGCCCTGGAGCTAAGTAGG - Intergenic
965514147 3:169602628-169602650 TTTTCTCCCTGGGGTAAAGTTGG - Intronic
966030842 3:175345871-175345893 TATTGCCCCTGCAGGAAAGTGGG - Intronic
969818834 4:9705632-9705654 TTTTGCTCCTGGAGTAGAATTGG - Intergenic
971237723 4:24857808-24857830 CTTGGCCCCTGGAGTACAGTGGG + Intronic
975456669 4:74598817-74598839 TATTGCCCCTTGAGTATGGGTGG - Intergenic
979638123 4:122979578-122979600 TGTTGCCACTGGAGGAAACTGGG - Intronic
979903253 4:126250706-126250728 TATTGTCATTGGAGTGAAGTGGG - Intergenic
982172676 4:152677039-152677061 TTCTGCTCATGGAGTAAAGTGGG - Intronic
983066922 4:163221795-163221817 TATTTCCCCTAGTTTAAAGTTGG + Intergenic
985042351 4:185904358-185904380 CACTACCCCTGGAGTAAGGTGGG - Intronic
988550804 5:32199166-32199188 TATTTCATCAGGAGTAAAGTAGG + Intergenic
991547990 5:67804866-67804888 TTTTGACCCTGAAGTAAAGTAGG + Intergenic
992861521 5:80915780-80915802 TATTGCAGCTGGAATGAAGTTGG - Intergenic
994915638 5:105974390-105974412 TATTGCCCCTGGCGTTAGGATGG + Intergenic
995494206 5:112724440-112724462 TATTGCGCCTGGTCCAAAGTAGG - Intronic
995727361 5:115195296-115195318 TGTTGCCTCTGGAGAGAAGTGGG + Intergenic
996716923 5:126595468-126595490 TATTGGCGCTGAAGTACAGTAGG + Intergenic
996899195 5:128524123-128524145 CCATGTCCCTGGAGTAAAGTGGG - Intronic
1000376982 5:160591966-160591988 TCTTGCACCTGGAGGAAAGAAGG - Intronic
1000475572 5:161702675-161702697 TATTGCCCCTGGTGAGAGGTAGG + Intergenic
1007203285 6:40129382-40129404 TTTTGCCCCTGGAGGAGAGAGGG - Intergenic
1011961328 6:93094068-93094090 TTTTGCCCCTGGAGTTGAGGAGG - Intergenic
1013003518 6:106048624-106048646 TAGTGAACCTGCAGTAAAGTGGG + Intergenic
1013218070 6:108048684-108048706 GATTACCCCTGGAATAAGGTTGG - Intronic
1017769868 6:157636655-157636677 CATTCCCCCTGGAGAAAAGTGGG + Intronic
1018657527 6:166053771-166053793 TATAGCCCCAGTATTAAAGTGGG + Intergenic
1020319392 7:6928953-6928975 TTTTGCTCCTGGAGTAGAATTGG + Intergenic
1020520179 7:9175400-9175422 TATTACCACTGGAGAAAACTGGG + Intergenic
1023025537 7:36046463-36046485 TGATGCCCTTGGAATAAAGTTGG - Intergenic
1023255588 7:38309489-38309511 TAATACGCCTGGAATAAAGTGGG + Intergenic
1023291637 7:38674218-38674240 GACTGCCCCTGGAGTAATGGAGG - Intergenic
1025835649 7:65091192-65091214 TTTTGGCTCTGGAGTAGAGTGGG + Intergenic
1025905427 7:65780668-65780690 TTTTGGCTCTGGAGTAGAGTGGG + Intergenic
1026039379 7:66854634-66854656 TTTTGCCTCTGGAGTGAAATGGG + Intergenic
1026607694 7:71829673-71829695 AATAGCCTCTAGAGTAAAGTGGG + Intronic
1027620316 7:80476951-80476973 TATTGCACCTGCAGTAATCTGGG + Intronic
1029025058 7:97407660-97407682 TATTTCCAATGGAGAAAAGTTGG - Intergenic
1030564672 7:111138412-111138434 TATGGCCCCTGGAGTTAATTTGG - Intronic
1032055465 7:128681095-128681117 TCTTGCCCCTGGATAAAAGCTGG + Intronic
1037367080 8:18134659-18134681 TTTTTCCCCTGGAGAAAACTAGG - Intergenic
1040048333 8:42986069-42986091 TATTGTCCCTGCAGTAAATATGG + Intronic
1043504052 8:80885604-80885626 CATTTCCCCTGGACTAAAGCAGG - Intergenic
1046152352 8:110244370-110244392 TATTGCCCCTGCACCTAAGTTGG - Intergenic
1047573771 8:126130910-126130932 AATGGTCCCTGGAGTGAAGTTGG + Intergenic
1048035346 8:130672608-130672630 TGTAGACCCTGGAGGAAAGTTGG + Intergenic
1048637669 8:136315864-136315886 GATTGGCTCTGGACTAAAGTTGG - Intergenic
1048742661 8:137579360-137579382 TTTTGCCCTTGGAGCAAAGAAGG - Intergenic
1052004311 9:23328407-23328429 TATTGCACCTGAAGAAAAATGGG - Intergenic
1052558019 9:30045103-30045125 TATTGCCATTGGGGGAAAGTGGG + Intergenic
1055406170 9:75975905-75975927 TTTTGACCCTGGAGTGAAGCTGG + Intronic
1059531989 9:115043662-115043684 TATGGCCCATGGAGGAAAGAGGG - Intronic
1060859151 9:126939591-126939613 TATTTCCCCTTCTGTAAAGTGGG - Intronic
1061888672 9:133606225-133606247 TGTTGCCCCTGGGGTGAAGTGGG - Intergenic
1062723428 9:138057551-138057573 TTTTGTCTATGGAGTAAAGTAGG + Intronic
1188746221 X:33847511-33847533 TATAGCCCCTGAAGTAAGGAAGG + Intergenic
1195497667 X:105556059-105556081 TAATGCCTCTGGATTAAAGAAGG - Intronic
1197198799 X:123731610-123731632 TGTTTCCCCTTGAGTAAATTGGG - Intronic
1199431595 X:147767260-147767282 TGTTGCCACTGGAGGAAAGTGGG - Intergenic
1200432758 Y:3107628-3107650 TATTCCCCCTGAAAGAAAGTGGG + Intergenic
1201647307 Y:16249354-16249376 TATTTGCCCTGGAGTAATTTGGG - Intergenic
1201655504 Y:16335948-16335970 TATTTGCCCTGGAGTAATTTGGG + Intergenic