ID: 913050681

View in Genome Browser
Species Human (GRCh38)
Location 1:115114379-115114401
Sequence GGTGAGGCAAGGCCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913050681_913050686 -9 Left 913050681 1:115114379-115114401 CCCACAGTGGGCCTTGCCTCACC No data
Right 913050686 1:115114393-115114415 TGCCTCACCTCTGGCTGGAGAGG No data
913050681_913050689 1 Left 913050681 1:115114379-115114401 CCCACAGTGGGCCTTGCCTCACC No data
Right 913050689 1:115114403-115114425 CTGGCTGGAGAGGTTGCAGCTGG No data
913050681_913050690 16 Left 913050681 1:115114379-115114401 CCCACAGTGGGCCTTGCCTCACC No data
Right 913050690 1:115114418-115114440 GCAGCTGGTTGCCAAGCCCCTGG No data
913050681_913050692 30 Left 913050681 1:115114379-115114401 CCCACAGTGGGCCTTGCCTCACC No data
Right 913050692 1:115114432-115114454 AGCCCCTGGAATGCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913050681 Original CRISPR GGTGAGGCAAGGCCCACTGT GGG (reversed) Intergenic