ID: 913060702

View in Genome Browser
Species Human (GRCh38)
Location 1:115204105-115204127
Sequence CACTCTACACATGTGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913060702_913060704 -5 Left 913060702 1:115204105-115204127 CCAAGCTGCACATGTGTAGAGTG No data
Right 913060704 1:115204123-115204145 GAGTGAAATTCCACAAAGGTTGG No data
913060702_913060705 -4 Left 913060702 1:115204105-115204127 CCAAGCTGCACATGTGTAGAGTG No data
Right 913060705 1:115204124-115204146 AGTGAAATTCCACAAAGGTTGGG No data
913060702_913060703 -9 Left 913060702 1:115204105-115204127 CCAAGCTGCACATGTGTAGAGTG No data
Right 913060703 1:115204119-115204141 TGTAGAGTGAAATTCCACAAAGG No data
913060702_913060707 12 Left 913060702 1:115204105-115204127 CCAAGCTGCACATGTGTAGAGTG No data
Right 913060707 1:115204140-115204162 GGTTGGGCAAAGAAAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913060702 Original CRISPR CACTCTACACATGTGCAGCT TGG (reversed) Intergenic
No off target data available for this crispr