ID: 913062016

View in Genome Browser
Species Human (GRCh38)
Location 1:115217091-115217113
Sequence GGGAGAGAAGAGGTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913062016_913062022 7 Left 913062016 1:115217091-115217113 CCTGGAGGCACCTCTTCTCTCCC No data
Right 913062022 1:115217121-115217143 GCCCAAATGATGAGCTGGGCTGG No data
913062016_913062020 2 Left 913062016 1:115217091-115217113 CCTGGAGGCACCTCTTCTCTCCC No data
Right 913062020 1:115217116-115217138 TGCATGCCCAAATGATGAGCTGG No data
913062016_913062021 3 Left 913062016 1:115217091-115217113 CCTGGAGGCACCTCTTCTCTCCC No data
Right 913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG No data
913062016_913062024 8 Left 913062016 1:115217091-115217113 CCTGGAGGCACCTCTTCTCTCCC No data
Right 913062024 1:115217122-115217144 CCCAAATGATGAGCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913062016 Original CRISPR GGGAGAGAAGAGGTGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr