ID: 913062017

View in Genome Browser
Species Human (GRCh38)
Location 1:115217101-115217123
Sequence GGCATGCACAGGGAGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913062017_913062021 -7 Left 913062017 1:115217101-115217123 CCTCTTCTCTCCCTGTGCATGCC No data
Right 913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG No data
913062017_913062022 -3 Left 913062017 1:115217101-115217123 CCTCTTCTCTCCCTGTGCATGCC No data
Right 913062022 1:115217121-115217143 GCCCAAATGATGAGCTGGGCTGG No data
913062017_913062020 -8 Left 913062017 1:115217101-115217123 CCTCTTCTCTCCCTGTGCATGCC No data
Right 913062020 1:115217116-115217138 TGCATGCCCAAATGATGAGCTGG No data
913062017_913062024 -2 Left 913062017 1:115217101-115217123 CCTCTTCTCTCCCTGTGCATGCC No data
Right 913062024 1:115217122-115217144 CCCAAATGATGAGCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913062017 Original CRISPR GGCATGCACAGGGAGAGAAG AGG (reversed) Intergenic
No off target data available for this crispr