ID: 913062021

View in Genome Browser
Species Human (GRCh38)
Location 1:115217117-115217139
Sequence GCATGCCCAAATGATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913062017_913062021 -7 Left 913062017 1:115217101-115217123 CCTCTTCTCTCCCTGTGCATGCC No data
Right 913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG No data
913062016_913062021 3 Left 913062016 1:115217091-115217113 CCTGGAGGCACCTCTTCTCTCCC No data
Right 913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913062021 Original CRISPR GCATGCCCAAATGATGAGCT GGG Intergenic
No off target data available for this crispr