ID: 913062021 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:115217117-115217139 |
| Sequence | GCATGCCCAAATGATGAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913062017_913062021 | -7 | Left | 913062017 | 1:115217101-115217123 | CCTCTTCTCTCCCTGTGCATGCC | No data | ||
| Right | 913062021 | 1:115217117-115217139 | GCATGCCCAAATGATGAGCTGGG | No data | ||||
| 913062016_913062021 | 3 | Left | 913062016 | 1:115217091-115217113 | CCTGGAGGCACCTCTTCTCTCCC | No data | ||
| Right | 913062021 | 1:115217117-115217139 | GCATGCCCAAATGATGAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913062021 | Original CRISPR | GCATGCCCAAATGATGAGCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||