ID: 913064753

View in Genome Browser
Species Human (GRCh38)
Location 1:115240347-115240369
Sequence CACAGTGAGCACAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913064753_913064755 -10 Left 913064753 1:115240347-115240369 CCTTCCTCTCTGTGCTCACTGTG No data
Right 913064755 1:115240360-115240382 GCTCACTGTGTTCAATAACTCGG No data
913064753_913064756 -6 Left 913064753 1:115240347-115240369 CCTTCCTCTCTGTGCTCACTGTG No data
Right 913064756 1:115240364-115240386 ACTGTGTTCAATAACTCGGAAGG No data
913064753_913064757 7 Left 913064753 1:115240347-115240369 CCTTCCTCTCTGTGCTCACTGTG No data
Right 913064757 1:115240377-115240399 ACTCGGAAGGAGACTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913064753 Original CRISPR CACAGTGAGCACAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr