ID: 913068968

View in Genome Browser
Species Human (GRCh38)
Location 1:115283171-115283193
Sequence GAGCTGGAATAGAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913068968_913068979 16 Left 913068968 1:115283171-115283193 CCTTTTGTCCTCTATTCCAGCTC No data
Right 913068979 1:115283210-115283232 CCATGATGTGGATGATGCTGAGG No data
913068968_913068980 25 Left 913068968 1:115283171-115283193 CCTTTTGTCCTCTATTCCAGCTC No data
Right 913068980 1:115283219-115283241 GGATGATGCTGAGGAGAAAGTGG No data
913068968_913068974 4 Left 913068968 1:115283171-115283193 CCTTTTGTCCTCTATTCCAGCTC No data
Right 913068974 1:115283198-115283220 CGGATCCTCCTCCCATGATGTGG No data
913068968_913068981 30 Left 913068968 1:115283171-115283193 CCTTTTGTCCTCTATTCCAGCTC No data
Right 913068981 1:115283224-115283246 ATGCTGAGGAGAAAGTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913068968 Original CRISPR GAGCTGGAATAGAGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr