ID: 913070092

View in Genome Browser
Species Human (GRCh38)
Location 1:115290685-115290707
Sequence TAAGAGATAGAGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 727}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913070092_913070099 4 Left 913070092 1:115290685-115290707 CCCTGCCCCTTCTCTATCTCTTA 0: 1
1: 0
2: 7
3: 58
4: 727
Right 913070099 1:115290712-115290734 CTTCCCTTTATATTCTCTTAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
913070092_913070098 3 Left 913070092 1:115290685-115290707 CCCTGCCCCTTCTCTATCTCTTA 0: 1
1: 0
2: 7
3: 58
4: 727
Right 913070098 1:115290711-115290733 CCTTCCCTTTATATTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913070092 Original CRISPR TAAGAGATAGAGAAGGGGCA GGG (reversed) Intronic
900584979 1:3428354-3428376 TAAGAGAAAGAGATGTGGCCGGG + Intronic
900732437 1:4271181-4271203 TACAGGAAAGAGAAGGGGCATGG + Intergenic
901265162 1:7904607-7904629 TAAGACATGGAAAAGGGGCTGGG + Intergenic
901689784 1:10965219-10965241 GAAGAGAAAGAGGAGGAGCAGGG + Intronic
901695053 1:11001324-11001346 TAAGGGATATGGAAGGGGCTGGG + Intergenic
901845731 1:11980749-11980771 TGAAAAATAGAGAAGGGGCAGGG - Intronic
902675372 1:18005078-18005100 GAAGAAACAGAGAAGGGGCTTGG + Intergenic
903024763 1:20419503-20419525 TAAAAGAAAGAGAAGAGTCAAGG + Intergenic
903422040 1:23225064-23225086 TCAAAGACAGAGAAGAGGCATGG - Intergenic
903939949 1:26922663-26922685 TCAGAGCCAGAGAAGTGGCAAGG + Intronic
904147147 1:28402105-28402127 TGAGAGAAAGAGAAGAGTCAAGG + Intronic
905121923 1:35688933-35688955 TGAGAGAGAGAGAAGGGGAATGG + Intergenic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905425881 1:37884365-37884387 TAAGAGAAAGGGAAGGGGAGGGG - Intronic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906186711 1:43867711-43867733 TAAGACAACAAGAAGGGGCAGGG - Intronic
906287389 1:44596264-44596286 AAAAAGACAGAGAAGGGGCTGGG + Intronic
906353620 1:45084388-45084410 TATGAGATTTAGAAGGGGCCAGG - Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906821130 1:48931465-48931487 TAAGAGATAGAGAAGGTTAAGGG - Intronic
907270440 1:53287967-53287989 AAAGAGATAGAGACGGGGGTGGG + Intronic
908233356 1:62127508-62127530 TAAGAGCTAGAGCTGGGGCTGGG + Intronic
908250275 1:62260277-62260299 TCAGAGAGAGAGAAGGAGGAAGG - Intronic
908262381 1:62349331-62349353 TAAGTGAGAGAGGAGGGGAAGGG + Intergenic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
909081389 1:71116765-71116787 AAAGCGTTAGAGAAGGGGCAGGG - Intergenic
909198605 1:72659104-72659126 TAAGGGAAAAAGAAGTGGCAAGG - Intergenic
909230849 1:73087762-73087784 TCAGAGACAGGGAAGGGGAATGG - Intergenic
909799498 1:79788383-79788405 TAAAAGATTGAGACTGGGCATGG + Intergenic
910463823 1:87475328-87475350 TAAGTGAGACAGAAGGGACAGGG - Intergenic
911067970 1:93809038-93809060 GAAGAGAGAGAGAAGCGGGAGGG + Intronic
911601509 1:99852934-99852956 TAAAGGATCGAGAATGGGCAGGG - Intronic
911783881 1:101919987-101920009 TAAGAGACAGAAAAGAGTCAAGG - Intronic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911795351 1:102069061-102069083 TAAGAAATATAGAAGTGTCATGG + Intergenic
911824145 1:102460203-102460225 AAAGAGATAGAGAAAGGGGCAGG - Intergenic
912515447 1:110213871-110213893 ATAGAGATAGAGATGGGGAAAGG + Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
913138632 1:115917454-115917476 TAAGATTTAGGGTAGGGGCATGG + Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
913630616 1:120706062-120706084 CAAGAGAAAGAGAAGAGTCAAGG - Intergenic
915331920 1:155117964-155117986 AAAGAGCTAGAGAGGGGGCTGGG - Intergenic
915469879 1:156119563-156119585 AAAGAGACAGAGAAGGGGCAGGG - Intronic
915988956 1:160493853-160493875 GGAGAGAGAGAGAAAGGGCAAGG + Intronic
916026068 1:160834644-160834666 AAAGAGTTAGAGAAGAGGCCAGG - Intronic
916060492 1:161095178-161095200 TGAGAAATAGAGAAGGGTCAGGG + Intergenic
917535709 1:175872947-175872969 AAAGGGAGAGAGAAGGGACAAGG + Intergenic
917824013 1:178797349-178797371 TGAGAGGTAGAGGTGGGGCAGGG + Intronic
917906473 1:179591196-179591218 TAAGAGATATAGAATAGGGAGGG - Intergenic
918216397 1:182395143-182395165 TAAAAGACAGAGAAAGGGCCGGG - Intergenic
918581198 1:186132130-186132152 GAAGAGAAAGAGGAGGGGGAAGG - Intronic
919523789 1:198621969-198621991 AAAGAGAGAGAGAAGAGGGAGGG + Intergenic
920045955 1:203132523-203132545 TAACAGATGGTGAAGGGGAAAGG - Intronic
920637166 1:207714775-207714797 TAAGAAAAAAAGAAGGGTCAGGG - Intronic
921283433 1:213588587-213588609 TAAGAGACAGAGGCCGGGCATGG - Intergenic
921590311 1:216995149-216995171 CAAGAGATGAAGGAGGGGCAGGG - Intronic
921593505 1:217030136-217030158 AAAGAGAAAGAGAAAGGGAAAGG - Intronic
922022139 1:221716068-221716090 TGAGAGACAGAGAAGGTGTAGGG - Intronic
922107387 1:222524352-222524374 TGAGAGATAGAGTTGGAGCAAGG - Intronic
922915040 1:229250285-229250307 TAAGAAATAGAGACTGGGCATGG - Exonic
923054044 1:230412085-230412107 ACAGAGATAGAGAAGGAGAAGGG + Intronic
923177111 1:231477502-231477524 TATGAGATAGAGGCCGGGCATGG + Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
923913950 1:238481991-238482013 GAAAAGACAGAGAAGGGGAAAGG + Intergenic
924086238 1:240454731-240454753 TTAGGGATAGAGAAGGGGCTGGG + Intronic
924690903 1:246349307-246349329 TAAGAGAGGGAGCAGGGGCCGGG + Intronic
924715539 1:246569716-246569738 TAAGAGAAAGAGGCTGGGCATGG - Intronic
1062778839 10:181666-181688 AAGGAGATAGAGAAGGGGTGAGG + Intronic
1063111085 10:3037980-3038002 TAAGAATAAGAGAAGGGGCCGGG + Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064586748 10:16846834-16846856 AAAGAAAAAGAAAAGGGGCACGG + Intronic
1064862357 10:19841271-19841293 TGAGAAATAAAGAATGGGCATGG - Intronic
1065953407 10:30673004-30673026 AAAGTGATGGAGAAGGGGCCAGG - Intergenic
1066334606 10:34463130-34463152 AAAGGGAAAGAGAAGGGGAAGGG + Intronic
1067914480 10:50381804-50381826 TAACAGATAGAGAAGGTCAAGGG - Intronic
1068003011 10:51358611-51358633 TAATAGAAAGAGAAGAGACAAGG + Intronic
1068695058 10:59958930-59958952 GAAGAAAGAGAGAAGGGGGAAGG - Exonic
1068699803 10:60007904-60007926 TAAAAGATAGAAAAATGGCAGGG - Intergenic
1068758517 10:60681816-60681838 TAAAAGACAGAGAAAGGACAGGG + Intronic
1070592476 10:77810850-77810872 GAAGAGAAAGAGAAGATGCAGGG + Intronic
1071784902 10:88888213-88888235 GAAGACACAGAGAAGGGGAAAGG + Intronic
1071808230 10:89147736-89147758 TAAGAGAGAGATGAGGGACAAGG + Intergenic
1072201936 10:93168054-93168076 AAAGAGAGAGCGAAGGGGGAAGG + Intergenic
1072741343 10:97911806-97911828 TAAGAGATGGAGGAGAGGGAGGG - Intronic
1072783876 10:98267799-98267821 GAGGAGACAGGGAAGGGGCAAGG - Intronic
1072788189 10:98298836-98298858 TAGGAGATGGTGAAGGGGCCTGG + Intergenic
1072962518 10:99941761-99941783 TAAGAGACTGAGAAGAGGCCAGG - Intronic
1073265802 10:102227776-102227798 TAAGATCTAGAGAAGAGGCAGGG - Intronic
1073267591 10:102237320-102237342 CAAGAGGAAGAGAAGGGGTATGG + Intronic
1073387152 10:103135180-103135202 CAAGAGATTTAGAAGGGCCAGGG + Intronic
1073712275 10:106057212-106057234 AAAGAAATAAAGAAGGGGAAAGG - Intergenic
1074227467 10:111499607-111499629 TAAGAAATAGAGAATCGGAATGG + Intergenic
1074568885 10:114606698-114606720 AATGAGATAGAGAAGAGGAAAGG - Intronic
1074617203 10:115081225-115081247 TAAGAAATACAGAAAGGGCCAGG - Intergenic
1074752998 10:116604981-116605003 TAAGAGAAAGAGGCCGGGCATGG - Intronic
1075264575 10:120989691-120989713 AAAGAGAGAGAGAGGTGGCAGGG - Intergenic
1075478708 10:122760047-122760069 TAAGAGAGAGTGAATGAGCATGG - Intergenic
1075679198 10:124320532-124320554 AAAGAGATAGGCAAGGGGCTAGG + Intergenic
1076825898 10:132967885-132967907 TAAATGATAGGGAAGGGGGAAGG - Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077739990 11:4835168-4835190 GAAGAGAGAGAGAGGGGGGAGGG - Intronic
1077768391 11:5187409-5187431 AAAGAGATGGAGAAAGGACAAGG + Intergenic
1077772526 11:5235559-5235581 GAAGAGAAAGAGAAAGGGAAGGG + Intergenic
1077822682 11:5765208-5765230 TAAGAGGTAGAGCAGAGCCAGGG - Intronic
1077854371 11:6107885-6107907 TAAGAGGTAGAGCAGAGTCAGGG - Exonic
1077988956 11:7384477-7384499 GAAGTGATAGAGAAGAGTCAAGG - Intronic
1078172814 11:8941857-8941879 TAAGAGAGAAAGAACGGGTATGG + Intergenic
1078416067 11:11166045-11166067 AAAGAGAAAGAGAAAGTGCAAGG - Intergenic
1079173215 11:18115859-18115881 AGATGGATAGAGAAGGGGCATGG - Intronic
1079178700 11:18169253-18169275 TAAGGGAAAGAGATGAGGCATGG + Intronic
1079444356 11:20545933-20545955 TCAGAGAAAGAGAGGGAGCAAGG - Intergenic
1079454244 11:20623359-20623381 TGAGAGAAAGAGAAGAGTCAAGG - Intronic
1079556309 11:21761874-21761896 AAAGACAAGGAGAAGGGGCAAGG + Intergenic
1079784023 11:24648344-24648366 TAAGAGATAGGTTAGGGGAAAGG - Intronic
1081114103 11:39176506-39176528 TAAGAGATAGACAAGGGTTTAGG + Intergenic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1081850571 11:46272601-46272623 TAAGAGGAAGGGCAGGGGCACGG - Intergenic
1083058870 11:59848869-59848891 CAAGAGTTAGACATGGGGCAGGG - Intergenic
1083278272 11:61609643-61609665 TGAGAGAGAGAGAGGGGGAAGGG + Intergenic
1083321797 11:61852232-61852254 AGAGAGAAAGAGAAGGGGAAAGG - Intronic
1083820989 11:65171331-65171353 TAGGAGATGGAGATGGGGCAGGG - Exonic
1083827924 11:65213669-65213691 AGAGAGCTAGAGAAAGGGCATGG + Intergenic
1084038728 11:66529608-66529630 TAAGAGAGTGAGAAGAGGCAGGG + Intronic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1085786287 11:79453924-79453946 TATGAGAAAGGGAAGGGGAAGGG - Intergenic
1085929433 11:81063586-81063608 TAAGTGAAAGAGAAGAGGCAAGG - Intergenic
1085998085 11:81946802-81946824 AAAGAGATTGAGAAGTGGCCAGG + Intergenic
1086266322 11:85002773-85002795 GAAGAGATAGAGGAGGTGAAAGG - Intronic
1086395980 11:86415392-86415414 TATGAGAAAGATGAGGGGCAGGG - Intronic
1086769143 11:90739122-90739144 TGAGAGATAGAGGTGGGGCGGGG - Intergenic
1086831835 11:91575971-91575993 TAAGAGATGGGGTTGGGGCAGGG + Intergenic
1087974828 11:104531718-104531740 TGAGAGAGAGAGATGGGGGAGGG + Intergenic
1088919539 11:114251180-114251202 AAAGAGCTGGAGGAGGGGCAGGG - Intergenic
1089197208 11:116701288-116701310 TAAGAGATGGAGCTGGGACATGG + Intergenic
1089767675 11:120779764-120779786 TAAGAGAAAGAAAACAGGCAAGG - Intronic
1089964961 11:122648177-122648199 GAAGAGATAGATTATGGGCAGGG - Intergenic
1090138971 11:124233475-124233497 TAGGAGATTGGGAAGGGGCATGG - Intergenic
1090208082 11:124896706-124896728 TAAGGGAGAGAGAAGAGGCCTGG - Intronic
1091192394 11:133706763-133706785 GAAGGGAAAGAGAAAGGGCAGGG + Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091678992 12:2512785-2512807 TGAGAGTGAGAGGAGGGGCAGGG - Intronic
1091821214 12:3476560-3476582 TAAGAGAGAGAGATGGGAGAGGG - Intronic
1093123062 12:15295972-15295994 GAAGAGAGAGAGAAAGGGGAGGG - Intronic
1093201862 12:16197422-16197444 AAAAAGATATAGAAAGGGCATGG + Intronic
1093387889 12:18582152-18582174 GGAGAGAAATAGAAGGGGCAAGG + Intronic
1094072802 12:26437201-26437223 TAAAAGTTAGAGAATGGACAAGG - Intronic
1095315781 12:40759459-40759481 AAAGAGAAAGAGAAAGGGAAAGG - Intronic
1095956061 12:47806920-47806942 AGAGAGAGAGAGATGGGGCAGGG - Intronic
1095956109 12:47807234-47807256 TAAGAGATAGGGCAGGGGGCTGG - Intronic
1096008328 12:48190340-48190362 TGAGAGAGGGAAAAGGGGCAAGG - Intergenic
1096092330 12:48911262-48911284 TTAGAAATAGAGATGGGGCCAGG + Intronic
1096632476 12:52937390-52937412 AGAGAGATACAGATGGGGCAGGG + Intronic
1096744236 12:53715128-53715150 CAAGACAGAGAGAAGGGGTATGG + Intronic
1097916286 12:65023652-65023674 AGAGAGATAGGGAAGGGGAAAGG - Intergenic
1098075993 12:66732148-66732170 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1098126518 12:67300449-67300471 TGGGAGATGGGGAAGGGGCAGGG - Intronic
1098221787 12:68277801-68277823 TAAGAGAAAGAGAAGGTGATGGG + Intronic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098638588 12:72813810-72813832 TAAGAGAAAGAGAAGAGCCAAGG - Intergenic
1099724890 12:86412835-86412857 TCAGTGTTAGAGAAGGGGCCTGG + Intronic
1100265073 12:92968040-92968062 TGACAGAGAGAGAAGGTGCAAGG + Intergenic
1101546406 12:105717454-105717476 TAAAAGAGAGAGCAGAGGCAAGG + Intergenic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1101802014 12:108030699-108030721 CAAGAGATGGAGATGGGACAGGG + Intergenic
1102717497 12:114986718-114986740 TGAGAGATAGAAAAGGAGGAAGG - Intergenic
1102773313 12:115497545-115497567 AAAGAGAAAGAGAAGGACCAGGG + Intergenic
1103053625 12:117801789-117801811 TATCAGATGGAGAAGGGGCCAGG + Intronic
1103166564 12:118774762-118774784 TAAGAGAGAGACAAAGAGCAGGG + Intergenic
1103404532 12:120666036-120666058 AGAGAGAGAGAGAAGGGGCTGGG + Intronic
1104044171 12:125150051-125150073 ACAGAGAGAAAGAAGGGGCATGG - Intergenic
1104539043 12:129645271-129645293 TAAGAGAGAGAGAAAGGAAAAGG - Intronic
1104675583 12:130709932-130709954 TAAGAGGCATAGGAGGGGCAAGG + Intronic
1104795958 12:131517899-131517921 GGAGAGAGAGGGAAGGGGCAAGG + Intergenic
1105866618 13:24466497-24466519 TAAGAGAGAGAGAACTGGCTGGG + Intronic
1106832204 13:33596691-33596713 TCAGAGAAAGGGAAGGGTCAGGG - Intergenic
1106848668 13:33764859-33764881 TGAGAGAAAGAGGTGGGGCACGG - Intergenic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1107495739 13:40924047-40924069 TAAGAGATGGAGCAGGGGTGTGG + Intergenic
1108093902 13:46880448-46880470 TAAGAAGAAGAGAAGGGACAGGG - Intronic
1108874523 13:55028477-55028499 TAAGGGAAAGAGAAAGAGCAAGG + Intergenic
1108964077 13:56274582-56274604 AAAAAAAAAGAGAAGGGGCATGG - Intergenic
1109120312 13:58448135-58448157 TAAGAAAAAGAGAAGAGGCCAGG - Intergenic
1109130309 13:58575965-58575987 AGAGAGACAGAGAAGGGGGAAGG + Intergenic
1109147684 13:58801765-58801787 AAAGAGATAGGGAAGAGGGAGGG + Intergenic
1109245815 13:59953537-59953559 TAGGAGATAAAGAATGGGTAAGG + Intronic
1109385146 13:61619264-61619286 AAAGTGATAGTGAAGGGGGATGG + Intergenic
1109820301 13:67643929-67643951 TAAGAGAGAAAGGAGGGCCAAGG - Intergenic
1110121851 13:71892067-71892089 AAAAACTTAGAGAAGGGGCATGG - Intergenic
1110398879 13:75066291-75066313 AAAGAGATGGAGGATGGGCATGG + Intergenic
1110540388 13:76700904-76700926 AAAGAGAGAGGGAAGGGGGAGGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110730014 13:78869285-78869307 TTAGAGATAAATAAAGGGCATGG + Intergenic
1110735972 13:78937001-78937023 TAAGAGATAAATAAGGGGCAAGG - Intergenic
1110745912 13:79053359-79053381 TAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1112237656 13:97650871-97650893 TAAGAGATAGATGATGGCCAGGG - Intergenic
1112684414 13:101807048-101807070 TAAGAAAAAGAAAAGGGGCAGGG + Intronic
1112877490 13:104062492-104062514 TGAGAGAGAGAAATGGGGCAGGG - Intergenic
1114246737 14:20921302-20921324 TAAGAGATATAGAGGCTGCAGGG + Intergenic
1114498458 14:23150821-23150843 TTAGAAATTGAGAAGGGTCAGGG - Intronic
1114991297 14:28293448-28293470 TAAAAGATACAGAAGGGGCCAGG - Intergenic
1115741238 14:36391265-36391287 CAAAAGATAGAAAAGGGGAAGGG - Intergenic
1116088992 14:40279811-40279833 CAAGAGATAAACAAGGAGCAAGG - Intergenic
1116447856 14:45032844-45032866 TGAGAGATAGTGAAGGAACAAGG - Intronic
1116485655 14:45444948-45444970 TGAGAGAAAGAGAATGGGCAAGG - Intergenic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1117471872 14:56054549-56054571 AGAGAGAGAGAGAAAGGGCAAGG - Intergenic
1117547137 14:56802855-56802877 TAAGAGAGACAGAAGGGTGATGG - Intronic
1118891798 14:69916211-69916233 TGAGAGAAAGAGGAGGGTCAAGG - Intronic
1118895542 14:69942773-69942795 TGAAAGATTGAGAAGGAGCATGG + Intronic
1119287531 14:73467663-73467685 TAAGAGAGAGAGGAGTGGGAAGG - Intergenic
1119378490 14:74214002-74214024 TAAGAGGGAGAGAGTGGGCAGGG - Intergenic
1119647158 14:76356150-76356172 GAAGAGTCAGAGAAGGGGCTAGG + Intronic
1119971362 14:78974222-78974244 GAAGAGAGAGAGAAGGGGGCAGG + Intronic
1120683694 14:87512375-87512397 TGAGAAATATAGAAGGGGCTAGG - Intergenic
1121171260 14:91856326-91856348 TAAAAAATACAGAAAGGGCATGG + Intronic
1121266780 14:92608823-92608845 TAAGAGAGAGAGGCTGGGCACGG - Intronic
1121703493 14:95974144-95974166 CAAGACATAGAGAAGGGGTGAGG - Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1123670451 15:22651505-22651527 TAAGAGATAGAGAAGTGGAAAGG - Intergenic
1124526430 15:30457943-30457965 TAAGAGATAGAGAAGTGGGAAGG - Intergenic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1124772224 15:32549741-32549763 TAAGAGATAGAGAAGTGGGAAGG + Intergenic
1125661359 15:41397502-41397524 CAAGAGATAGAGACTGGGCCGGG + Intronic
1125947681 15:43723305-43723327 AAAGAAAGAGAGAAGGGGCAGGG + Intergenic
1126096571 15:45094764-45094786 CAAGAGACAGAGAATGGGGAGGG + Intronic
1126993978 15:54418502-54418524 ATATAGATAAAGAAGGGGCAGGG - Intronic
1127267570 15:57374255-57374277 AAGGAGAGAGAGAAGGGGAAGGG - Intergenic
1127297167 15:57618940-57618962 TAAGAGGCAGTGTAGGGGCAGGG + Intronic
1127940173 15:63687242-63687264 TAAGAAATAGTGAGGGGGCCAGG + Intronic
1128470315 15:67946195-67946217 CAAGAGGAAGAGAAGGGGAAGGG + Intergenic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1129328274 15:74813299-74813321 TCAGAGGTAGAGGAAGGGCAGGG - Intronic
1129639191 15:77356542-77356564 TAAGAGATTGACAAGAGTCATGG + Intronic
1129706920 15:77799619-77799641 AAAGAGAGAGAGAAAGGGCAAGG - Intronic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1131504691 15:93006418-93006440 TAAGAGAGAGAGAAAAGGCCGGG - Intronic
1131613416 15:93988625-93988647 AAAAAGGTAGAGAATGGGCAAGG + Intergenic
1131714712 15:95095801-95095823 AAAGAGGAAGAGAAGGAGCAAGG + Intergenic
1131955277 15:97728943-97728965 TGAGAGAGAGAGAGGGGCCAAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133004900 16:2874537-2874559 TAAGAAATGGGGGAGGGGCAGGG + Intergenic
1133101069 16:3480299-3480321 TAAAAGTTAGAGAAGGGGCCGGG + Intronic
1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG + Intronic
1133424160 16:5673216-5673238 GAAGTCACAGAGAAGGGGCAAGG + Intergenic
1133520350 16:6550133-6550155 TGAGAGATAGAGAGAGGGGAGGG - Intronic
1133611107 16:7434174-7434196 TAAGAGATGAAGGAGGGGCGGGG + Intronic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134428454 16:14177227-14177249 AAGGAGATAGAGGAGAGGCATGG + Intronic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135624395 16:23982055-23982077 GAAGGGAAAGAGAAGGGGAAGGG - Intronic
1135755658 16:25095718-25095740 TAAGAGAGAGCAGAGGGGCAGGG - Intergenic
1136136876 16:28261633-28261655 AAAGAGAAAGAGAGAGGGCATGG + Intergenic
1136242546 16:28953029-28953051 TAAGAGATAGAGCTGAGGCCGGG - Intronic
1136355337 16:29741578-29741600 TGAGTGATAGAGATGGGACAGGG + Intergenic
1136458132 16:30394011-30394033 AAAGAGAGAGAGAATGGGCTGGG - Intronic
1136622983 16:31442612-31442634 TAAGAGCGAGCGAAGGGGCCGGG - Intronic
1137397262 16:48124987-48125009 GAAGAGACAGGGAAGGGACAGGG + Intronic
1137650854 16:50119082-50119104 AAAGAAATAGTGAAGGGGCCAGG + Intergenic
1138490315 16:57372680-57372702 TGAGGGATAGACAAGGGGCTGGG - Intronic
1138578150 16:57922036-57922058 TATGAGATAGGGTAGGGGTAGGG - Intronic
1139693337 16:68655546-68655568 TATGAGATTGAGGAGGGGCTGGG + Intronic
1140226168 16:73079139-73079161 TAAGTGAAAGAGAAGGGGACTGG - Intergenic
1140721735 16:77778189-77778211 AAAGAGATAGTGACTGGGCATGG - Intergenic
1140873433 16:79127981-79128003 CAAGAGAGAGAGAAAGTGCATGG + Intronic
1141238513 16:82242902-82242924 TATGAAGTAGAGAAGGGGGATGG + Intergenic
1141241240 16:82266959-82266981 AAATAGATAGAGAGGGGGCTGGG - Intergenic
1141253794 16:82382487-82382509 GAAGAGATTGAGCAGGTGCAGGG + Intergenic
1141480107 16:84300672-84300694 TAAGAAAAGGAGAAGGGGCCAGG + Intronic
1141523803 16:84598685-84598707 GAAGAGAGAGGGATGGGGCAGGG + Intronic
1141755788 16:85989682-85989704 AGAGAAAGAGAGAAGGGGCAAGG - Intergenic
1141760563 16:86026098-86026120 GCAGAGACAGAGAAGGGGCGGGG + Intergenic
1143131659 17:4682200-4682222 TAAGAGATACAGAAAAGGCAAGG + Intronic
1143277561 17:5723032-5723054 CAAGAGGTAGAGATGGGGTAAGG - Intergenic
1143289822 17:5820290-5820312 TAAGAGATAGAGAGGGGAGCAGG - Intronic
1143558572 17:7677836-7677858 TAAGAGAGCGAGAAAGAGCAAGG + Intronic
1143622833 17:8090914-8090936 TCAGGGTGAGAGAAGGGGCAAGG + Intergenic
1144666154 17:17103596-17103618 TAAGAGACAGAGCAGGGGCCTGG - Intronic
1145002164 17:19313078-19313100 TAAGACAAAGAGAAGGGGACAGG - Intronic
1146025841 17:29320036-29320058 TAAGAGTTAGGGGAGGGGCCAGG + Intergenic
1146455219 17:33004418-33004440 GAAGAGAAAGAGAAAGGGGAAGG + Intergenic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146595819 17:34167643-34167665 TGAGAGACAGGGAAGGCGCATGG + Intronic
1146619427 17:34386073-34386095 TATGACACAGACAAGGGGCAGGG + Intergenic
1146938995 17:36830947-36830969 GAAGATATAGAGACCGGGCATGG + Intergenic
1147126739 17:38375279-38375301 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147510765 17:41067098-41067120 TGAGAGCTAGAGAAGGGACCTGG + Intergenic
1147675985 17:42205994-42206016 AGAGGGATAGAGAAGTGGCAGGG - Intronic
1148149536 17:45388482-45388504 TAACAGATACAGATCGGGCATGG + Intergenic
1148370718 17:47097992-47098014 TAAAACACAGAGAAGGGGCCAGG - Intergenic
1148614661 17:48991203-48991225 GAAGAGAGAGGGGAGGGGCAGGG + Intergenic
1148716439 17:49719382-49719404 GTAGAGATGGAGAAGGGGCAGGG + Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148762015 17:50009541-50009563 TCCCAGATAGAGAAGAGGCATGG - Intergenic
1149170112 17:53799529-53799551 CAAAATATGGAGAAGGGGCATGG - Intergenic
1149649590 17:58268598-58268620 TCAGAGAAAGGGGAGGGGCAGGG + Intergenic
1149793243 17:59497429-59497451 AAAGAGAGAGAGACTGGGCATGG - Intergenic
1150176446 17:63061836-63061858 TAAGAGAAAGAGAAGGTTAAAGG - Intronic
1150456371 17:65309826-65309848 TAAGAGTAAGAGAGGGGGCTGGG - Intergenic
1150843071 17:68627663-68627685 AAAGAGAAAGAGAAAGGGAAAGG - Intergenic
1150944250 17:69727205-69727227 AAAGAGAGAGAGAAGGGGGTGGG + Intergenic
1151191315 17:72400095-72400117 AAAGGGACAGAGAAGGGGCAGGG - Intergenic
1151217913 17:72590753-72590775 TAAAAGAAAGAGAAAGAGCATGG + Intergenic
1151340563 17:73468113-73468135 TGAGAGGTAGTGGAGGGGCAGGG + Intronic
1151449285 17:74187885-74187907 AAAGAAATAAAGGAGGGGCATGG + Intergenic
1151584653 17:75001809-75001831 TAAGTGATAGAGGAGTGACAAGG + Intronic
1153419404 18:4886957-4886979 CAAGAGATAGAGAAAGAGAATGG - Intergenic
1153807690 18:8723682-8723704 TAGGAGACAGAGAAGGTGCAGGG - Intronic
1154008125 18:10551623-10551645 AAAGAGACAGAGACAGGGCATGG - Exonic
1154211461 18:12382592-12382614 TAAAAGAGAGATAAGAGGCAGGG + Intergenic
1155135449 18:22987222-22987244 CAAGAGAGAGGGAAGGGGGAGGG + Intronic
1155729495 18:29135375-29135397 TAAAAGAAAGAGAAAGGGAAAGG + Intergenic
1156051269 18:32937185-32937207 AGAGAGAGAGAGATGGGGCAGGG - Intergenic
1156054184 18:32978739-32978761 TAAGAGTTAGAGAAAAGGCCGGG + Intronic
1156439589 18:37170884-37170906 ATAGAGATAGAGAGGGGGCTAGG + Intronic
1157135237 18:45047769-45047791 AGAGAGACAGAGAAGAGGCATGG + Intronic
1158123519 18:54077171-54077193 TTAGAGACAGGGAAGGGGGAAGG - Intergenic
1159503005 18:69298103-69298125 GGAGAGATGGAGAAGGGGCGAGG - Intergenic
1159780527 18:72655788-72655810 AAAGAGATAGAGATTGTGCAAGG - Intergenic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160364423 18:78312357-78312379 AAAGAAATTGAGAAGGGGCCAGG + Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161360718 19:3848032-3848054 CAAGATATAGTGCAGGGGCAGGG + Intronic
1162465236 19:10835782-10835804 TAAGAGATCCAGAGGGGGCGGGG - Intronic
1162605373 19:11702718-11702740 GAAGAGACAGAGAAAGGTCAGGG + Intergenic
1162857099 19:13477065-13477087 CAAGAGAGAGGGAAGGTGCAAGG - Intronic
1163117659 19:15197967-15197989 TAATAGAAGGGGAAGGGGCAGGG + Intronic
1163454000 19:17395274-17395296 AAGGAGGGAGAGAAGGGGCAGGG - Intergenic
1163461222 19:17438891-17438913 TAAGAGATAGAGCAGGTGTCGGG - Intronic
1164868729 19:31625950-31625972 GAAGAGATAGAGAAGTGGAGTGG - Intergenic
1165389913 19:35532890-35532912 CAAGAGACAGAGAAGAGGAAAGG + Intergenic
1165536101 19:36446539-36446561 AAAGAGAAAGAAAAGGGGCTGGG - Intronic
1165715627 19:38044084-38044106 TGAGAGAAAGAGAGGGGGCTAGG + Intronic
1165785742 19:38460636-38460658 TAGGAGTCAGAGAGGGGGCAGGG + Intronic
1166206951 19:41276304-41276326 TAGGAGCAAGAGAAGGGGAAGGG + Intronic
1166351830 19:42202560-42202582 TAAGAGATTGAATGGGGGCATGG - Intronic
1166827361 19:45617702-45617724 GAAGGGAGAGAGAAGAGGCAGGG + Intronic
1166929520 19:46293548-46293570 TAAGAGATAGAGGCCGGGCCGGG + Intergenic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167513667 19:49910337-49910359 TCAGAGAGAGAGATGGGGCCGGG + Intronic
1167723706 19:51196837-51196859 AGAGAGACAGAGAAGGGGAAAGG + Intergenic
1168061986 19:53898325-53898347 TAAGAGATGGAGGAAGGGCCTGG + Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168611269 19:57802524-57802546 CAAGACATTAAGAAGGGGCAGGG - Intronic
925300963 2:2812198-2812220 TGAGAGTGTGAGAAGGGGCATGG + Intergenic
925360427 2:3277030-3277052 TAAGAGAAAGAGAAGGTACCAGG + Intronic
925422451 2:3723940-3723962 AGAGAGACAGAGAAGGGGGAAGG - Intronic
925424680 2:3739255-3739277 TAAATGATACAGAAGGGGGAAGG + Intronic
925941913 2:8828822-8828844 TTAGAGTTAGGGAATGGGCATGG - Intronic
925991889 2:9260864-9260886 AAGCAGATAGAGTAGGGGCAGGG - Intronic
926943372 2:18161718-18161740 GAAGAGAAAGAGATGGTGCATGG - Intronic
927017633 2:18981888-18981910 GAAGAGATAGAAAAGGGGATGGG + Intergenic
927308485 2:21600943-21600965 GAAGAGAGAGAGAAAGGGTAGGG - Intergenic
927433775 2:23049469-23049491 TAAGAGAAAGAGAAGTGTCAAGG - Intergenic
927448490 2:23186511-23186533 TGAGAGAAAGAGAAGGGGACAGG + Intergenic
927803561 2:26123904-26123926 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
927846798 2:26476365-26476387 CAAGAGGTGGGGAAGGGGCAGGG + Intronic
928033879 2:27803749-27803771 TAAAAGACAGAGCAGGGGCCAGG + Intronic
928199302 2:29237078-29237100 TAAGAGAAAGAAAAGAGTCAAGG - Intronic
928870049 2:35965168-35965190 TTAGAGCCAGAGAAAGGGCAAGG + Intergenic
928984830 2:37170825-37170847 TAGGAGATAGTGAGTGGGCAAGG - Intronic
929389876 2:41457733-41457755 TAAGAGACAGAGAAAGGAAAAGG + Intergenic
929487348 2:42366811-42366833 CAAGAGAGAGAGAAAGGGAAGGG - Intronic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930126624 2:47803211-47803233 TAAAAGATAGAGCAGAGGCCAGG - Intronic
930180849 2:48355284-48355306 TGAGAGCTAGAGAATGGGAAAGG + Intronic
930289402 2:49474816-49474838 CCAGTGATGGAGAAGGGGCATGG + Intergenic
930752253 2:54945194-54945216 GAAGGGAGAGAGAAGGGGGAGGG - Intronic
931163015 2:59715152-59715174 TAAGAGAAAGAGAGGGGTCACGG - Intergenic
931744748 2:65282144-65282166 GAAGAGAGAGAGGAGGGGGAGGG - Intergenic
931795620 2:65706931-65706953 TTAGAGATATAGTAGGGTCAGGG + Intergenic
932177193 2:69613729-69613751 CAAGGGATGGGGAAGGGGCATGG - Intronic
932546643 2:72718560-72718582 TAAGAGAAATAAAAGGGGCCAGG + Intronic
933261253 2:80134288-80134310 TAAGAGTAAGAAGAGGGGCATGG + Intronic
933315168 2:80706553-80706575 TAAATGATAGGGAAGGGGGAAGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934640377 2:96024101-96024123 TCAGAGGTAGAGCATGGGCAGGG + Intronic
934793274 2:97081315-97081337 TCAGAGGTAGAGCATGGGCAGGG - Intergenic
935051479 2:99528695-99528717 GAAGAAAGAGAGAAGAGGCAGGG - Intergenic
935733231 2:106083877-106083899 TAAGAGGTAGGGAGGGGGCCAGG - Intergenic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
935867583 2:107407629-107407651 GAAGAGAAAGAGAAAGGGGAGGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936667892 2:114618860-114618882 TAAGAGAAAGAAAGGGAGCAGGG + Intronic
937013200 2:118580343-118580365 GAAGAGAGAGAGCAGGAGCAAGG - Intergenic
937096289 2:119237357-119237379 TAAGAGAGAGAGAGAGGGTAGGG + Intronic
937160845 2:119759828-119759850 GAAGAGATAGAGGAGGAGGAGGG + Exonic
937494059 2:122399513-122399535 TAAGATGTAGAGAAGAGGAAAGG - Intergenic
938222503 2:129582258-129582280 AAAGAGACAGAGGAGGGGCTGGG + Intergenic
938594701 2:132776323-132776345 AAGGAGGTGGAGAAGGGGCACGG - Intronic
939050833 2:137305671-137305693 TAAGAGATTTAAAAGGGGTAAGG - Intronic
939164715 2:138627885-138627907 AGAGAGAGAGGGAAGGGGCAGGG - Intergenic
939760265 2:146167531-146167553 TAAGAGCAAGAGTTGGGGCAAGG + Intergenic
940021364 2:149159632-149159654 AGAGAGAGAGAGTAGGGGCAAGG + Intronic
940102326 2:150055425-150055447 AGAGAGAGAGAGAAGCGGCAGGG - Intergenic
940372955 2:152922935-152922957 AAAGAAGAAGAGAAGGGGCAGGG - Intergenic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
940967521 2:159856408-159856430 CAAGAGCCAGAGAAGAGGCATGG + Intronic
941085053 2:161107803-161107825 GAAGACACAGAGAAGGGGAAAGG + Intergenic
941111811 2:161424506-161424528 TAAGAGAAAGACGAGGGGGAGGG - Exonic
941613130 2:167685659-167685681 TCAGAGAGAGAGCAGGGGCCAGG + Intergenic
941818845 2:169825363-169825385 GAAGAGATAGTGGAGAGGCAGGG + Intergenic
942766783 2:179466942-179466964 AAAGAGAGAGAGAAAGGGAAGGG + Intronic
943016877 2:182523290-182523312 TATGAGAGAGAGAAGGAGAAAGG + Intergenic
943824431 2:192371121-192371143 CAAGAGATAGTGAAGTGGGAGGG - Intergenic
944193360 2:197026896-197026918 TAAGAGAAAGAGAGAGGCCAAGG + Intronic
945532207 2:210969809-210969831 GAAGAAAGAGAGAAGGGGCCGGG - Intergenic
945700950 2:213170292-213170314 TAACAGTAAGAGAAGGGTCAGGG + Intergenic
946028860 2:216689657-216689679 TTAGAGACAGACAAGGGGCTGGG - Intronic
946059279 2:216927699-216927721 TTAGAGACTGAGAGGGGGCAGGG + Intergenic
946174954 2:217916900-217916922 TGAGGGACAGAGAATGGGCAGGG + Intronic
947278082 2:228417293-228417315 TAAGAGAGAGAGAGGGAGCTGGG + Intergenic
947719573 2:232362334-232362356 GAAGAGAGAGAGGAGGGGGAGGG - Intergenic
947812304 2:233012090-233012112 AGAGAAAGAGAGAAGGGGCAGGG + Intronic
947928712 2:233943936-233943958 TTTGAGATATATAAGGGGCAGGG + Intronic
1168979270 20:1991063-1991085 TAAGAGAGAGAGAAGTGGGGAGG + Intronic
1169243845 20:4009267-4009289 AAAGGGATAGAGGAGGGTCAGGG + Intronic
1169259538 20:4125673-4125695 TAAGCAATAGAGACTGGGCATGG - Intronic
1169741273 20:8897507-8897529 TCAGGGATAGAGAAGAGACATGG - Intronic
1169930543 20:10828130-10828152 TGAGAGAAAGAAAAGGGGCAAGG - Intergenic
1170845211 20:19956591-19956613 TAGGAGAAAGAGAAGCGGCACGG - Intronic
1172553656 20:35821864-35821886 TAAGAGATAGAGAAGAGTCAAGG + Intronic
1172607749 20:36225955-36225977 GAAGAGAGAGAGATGGGGCATGG - Intronic
1173040768 20:39460258-39460280 AGAGAGAAAGAGATGGGGCATGG + Intergenic
1173289898 20:41705477-41705499 GAAGAGGTGGAGAAGGGGAAAGG - Intergenic
1173613176 20:44385757-44385779 TAATAAATAGAGGTGGGGCATGG - Intronic
1173731210 20:45329966-45329988 CAAGTGATAGAGTAGGGGGAGGG + Intronic
1173847673 20:46198372-46198394 GGAGAGATGGAGAAGGGTCAAGG - Intronic
1174268902 20:49352433-49352455 TAAGAAAAAGACAAGAGGCAGGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1176790714 21:13316072-13316094 AAAGAGATAGAGAAGGAGAGAGG - Intergenic
1178058114 21:28821868-28821890 TAACAAATGGAGAAAGGGCAAGG - Intergenic
1179410666 21:41160573-41160595 TAAAAGAAAGAAAAGGGGCTGGG + Intergenic
1179911914 21:44455302-44455324 GAAGAGATGGGGGAGGGGCATGG - Intergenic
1180858392 22:19062542-19062564 CAACAGACAGGGAAGGGGCAGGG + Intronic
1180932584 22:19603226-19603248 AGAGAGAGAGAGATGGGGCATGG + Intergenic
1181962543 22:26633195-26633217 TGAGAGAAAGAGAAGGGTTATGG - Intergenic
1181965670 22:26655103-26655125 AAAGAGTTAGAGAAAAGGCAAGG - Intergenic
1182740844 22:32566375-32566397 TGAGAAAGAGAGAGGGGGCAAGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1182881865 22:33740626-33740648 TAAGAGAAAAAGAAGGGGTTAGG + Intronic
1183046302 22:35223154-35223176 AAAAAGATAAAGAAGGGGCCAGG + Intergenic
1184957577 22:47901976-47901998 TTAGAGTTGGGGAAGGGGCATGG - Intergenic
949431219 3:3977957-3977979 CAAAAGATAGAAAAGGGGAAAGG + Intronic
950575246 3:13828313-13828335 TGAGAAATAGAGAGGGGGCAAGG + Intronic
951324821 3:21288617-21288639 AAAGAGATGGAGATGGGGCCAGG - Intergenic
951720081 3:25689040-25689062 TAAGGGAGAGAGAAGGTGCTGGG + Intergenic
951880469 3:27476676-27476698 TAGGAGAGAGAGAAGTGGGAAGG - Intronic
952154225 3:30625881-30625903 TAGTAGTTAGAGATGGGGCATGG - Intronic
952361596 3:32635732-32635754 TAAGAGAAAAAGAAGAGTCATGG - Intergenic
952708256 3:36401882-36401904 CAAGAGAAAGGGAAGGGGAAAGG + Intronic
952957019 3:38563708-38563730 TCAGAGACAGAGAGGAGGCAGGG - Intronic
953191856 3:40695140-40695162 CAAGAGGCAGAGCAGGGGCAGGG + Intergenic
953510598 3:43534513-43534535 AAAGAGAGAGAGAAGGGGGTTGG + Intronic
954212871 3:49108332-49108354 TTAGAGAAGGAGAAGCGGCAAGG + Intronic
954349713 3:50032999-50033021 AAAGAAATAGAGAAGAGACAGGG + Intronic
954359148 3:50109366-50109388 TAAGAAAAAGAGAAGAGGCCGGG - Intronic
954366031 3:50146685-50146707 TAAGAGACAGAGGAGGGGTGAGG - Intergenic
954970605 3:54648827-54648849 TAAGAGAGAGAAAAGGGGTAGGG + Intronic
955501535 3:59589216-59589238 AAAGAGAGAGAGAATGGGAAAGG - Intergenic
955706904 3:61737181-61737203 TTAGAGAGAGAGAGGAGGCAGGG - Intronic
956272286 3:67460919-67460941 TAAGATATAAAGAAGGGGAGGGG + Intronic
956350489 3:68329814-68329836 TGAGAGATAGAGAAATGGGAGGG + Intronic
957328495 3:78728183-78728205 TAAAAGAGAGAGAAAGGGGAAGG + Intronic
957570378 3:81940140-81940162 GCAGAGATTAAGAAGGGGCAGGG - Intergenic
957923483 3:86778107-86778129 TAAGAGAGAGAGAAGAGAAAAGG + Intergenic
958126505 3:89363196-89363218 AGAGAGATAGAGAGGGGGCAGGG + Intronic
958536178 3:95407740-95407762 TAGGAGACAGATAAGGGGGAGGG + Intergenic
958705268 3:97646235-97646257 GAAGAGAAACAGAAGGGCCATGG + Intronic
959183682 3:103014601-103014623 TAATAGATAGGGAAGGTGGAAGG + Intergenic
959369470 3:105504876-105504898 TAAATGATACAGAAGGGGGAAGG - Intronic
959398922 3:105875405-105875427 TAATAGAAACAGAAGAGGCAAGG + Intergenic
961126702 3:124425111-124425133 TAAGAGATAGAGAAGGGTAGAGG + Intronic
961495293 3:127287177-127287199 TGGGAGATTGAGAAGGAGCATGG + Intergenic
962024728 3:131536002-131536024 TAATACATAGAGAAGGGGTAGGG + Intronic
962360713 3:134740585-134740607 GAAGAGAAAGAGGCGGGGCACGG - Intronic
963073143 3:141321546-141321568 GAAGAGATACACAAGGGACATGG + Intergenic
963093064 3:141504800-141504822 TAAGAGATGGAGTAAGGGTATGG - Intronic
963207434 3:142651162-142651184 TAAGAGATGGAGACAGGGCCGGG + Intronic
963374740 3:144449718-144449740 TAAGAGTTAGAGATGAGGCCGGG + Intergenic
963599525 3:147365602-147365624 TCAGAGTTAAAGAAGGGGGAAGG - Intergenic
963662325 3:148142446-148142468 TAAGAGAGAGGGAAGGGTCAAGG + Intergenic
963739588 3:149063348-149063370 AAAGAGATAGAGGCTGGGCACGG - Intronic
963985351 3:151587148-151587170 TAAGATATAGAGAGGCTGCATGG - Intergenic
964212846 3:154247185-154247207 GAAGAGACAGAGAAGAGGAATGG - Intronic
964277132 3:155020709-155020731 GAAGAGATAGAGAAGGAGGGAGG + Intergenic
964412009 3:156407717-156407739 TAAGTGTTTGAGAAGGGGAATGG - Intronic
964995939 3:162881358-162881380 AGTGAGATAGAGAAGGGGCACGG + Intergenic
965454920 3:168887650-168887672 TAAGAGATAAATAATGGCCAAGG - Intergenic
965584759 3:170307728-170307750 AAAGAAGTAGAGATGGGGCATGG - Intergenic
965853736 3:173063420-173063442 TTACAGAGAGAAAAGGGGCACGG + Intronic
966140624 3:176752368-176752390 AAAGAGAGAGAGAAGGGAAAGGG + Intergenic
966236892 3:177711847-177711869 TGAGAACTAGAGAAGTGGCAAGG - Intergenic
966591137 3:181684143-181684165 AAAGAGAGAGAGAAGGGGGGTGG - Intergenic
966673302 3:182554693-182554715 AAAGAAATAAAAAAGGGGCATGG - Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967733701 3:192930815-192930837 GGAGAGATAGATAAGGAGCATGG + Intergenic
967776677 3:193392693-193392715 AGAGAGATAGAGAAGGGCCAAGG - Intergenic
967854423 3:194105887-194105909 TAAGATATGGAGAAGGGCAAGGG - Intergenic
968711470 4:2122432-2122454 TCAGAGGTAGAGGAGGGGCAGGG + Intronic
969525304 4:7701202-7701224 GAAGAGGGAGAGAAGGGGGAAGG + Intronic
969551235 4:7868934-7868956 AAAGAGAAAGAGAAAGGGAAAGG + Intronic
969551239 4:7868994-7869016 AAAGAGAAAGAGAAAGGGAAAGG + Intronic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970535479 4:17026239-17026261 TGAGAGGTAGACAGGGGGCATGG - Intergenic
970542510 4:17094209-17094231 TGGGAGAGAGAGAAGGAGCAAGG + Intergenic
972416332 4:38844130-38844152 TAAGAGCTGGACATGGGGCAGGG + Intronic
972665285 4:41159217-41159239 AGAGAGATAGAGAAAGGGAAAGG - Intronic
973655610 4:53044581-53044603 AAGGAGAAAGAGAAGGGGAATGG - Intronic
975310076 4:72893976-72893998 TCAGCTACAGAGAAGGGGCAAGG + Intergenic
975593429 4:76023164-76023186 TAAGAGAAAGAGAAGGAAAAAGG - Intronic
975903266 4:79178981-79179003 CAAGAGAGAGAGAAGGGGTTTGG + Intergenic
976742196 4:88367917-88367939 GAAGAGAGAGAGAATGTGCAGGG + Intergenic
977013470 4:91662697-91662719 TGAGAGATTCAGAAGGAGCAGGG - Intergenic
977311828 4:95397038-95397060 TGAGTGCCAGAGAAGGGGCAGGG + Intronic
977439524 4:97045468-97045490 TAAGAGAAAGAGAACAGGTAAGG + Intergenic
978603380 4:110451596-110451618 GAAGAGAAAGAGAAGGGGAAGGG + Intronic
979352673 4:119663522-119663544 TCAGAGATTGAGAAGGAGAATGG + Intergenic
980423316 4:132592903-132592925 AAAGAGAAAGAGAAAGGGAAGGG + Intergenic
981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG + Intergenic
981547627 4:145910439-145910461 TGAGAGAAAGAGAAGAGTCAAGG - Intronic
981731380 4:147902896-147902918 GAAGAGAGAGAGAAGTGGGAGGG + Intronic
981989881 4:150905363-150905385 AAAGAGAGAGAGCAGGAGCAGGG + Intronic
982293192 4:153800162-153800184 TAAGAGAGTAGGAAGGGGCATGG - Intergenic
982325360 4:154124129-154124151 TCTGAGATTGAGAAGGGCCAGGG - Intergenic
983409396 4:167377766-167377788 TGGGAGATGGAGAAGCGGCATGG + Intergenic
984677622 4:182568380-182568402 AAACAGAATGAGAAGGGGCAAGG + Intronic
985045122 4:185932760-185932782 TAAGTCATAGAGAAGGATCATGG - Intronic
986174601 5:5341261-5341283 TAAGAGTTAGATAAAGGGCGTGG - Intergenic
986241030 5:5960258-5960280 AGAGAGAGAGAGGAGGGGCAGGG + Intergenic
986797483 5:11226081-11226103 TCCAAGATTGAGAAGGGGCAGGG - Intronic
986802460 5:11276421-11276443 AAAGAGATCAAGAAGGGGCCTGG - Intronic
986802751 5:11278853-11278875 AAAGAGACAAAGAAGGGGCCTGG - Intronic
987588899 5:19896434-19896456 TAAGAGAGAGGCAAGGGGCTAGG + Intronic
987778993 5:22407946-22407968 TGAGAGATAGAGAAGGCGATAGG - Intronic
987828879 5:23070123-23070145 CAAGAGATAGAGAATGGTAATGG - Intergenic
988489999 5:31698197-31698219 TAAGAAATAAGGAAGGGGCCGGG - Intronic
988917302 5:35907495-35907517 TTAGTGATAGAAAAGGGGTAAGG + Intronic
988962294 5:36382271-36382293 TAACTGATAGAGAAGCTGCAAGG - Intergenic
989027490 5:37084482-37084504 TAAAAGATACAGAATGGGCCAGG + Intergenic
989814901 5:45724133-45724155 TAAGAGAAAGAGAGGAGGCAAGG + Intergenic
990041862 5:51386564-51386586 TGAAAGATGGAGAAGGGGCCAGG + Intronic
990663163 5:58041755-58041777 AAAGAGACTGAGAAGGAGCAGGG + Intergenic
990976806 5:61568018-61568040 AAAGAGAAAGAGAAGGGGGGAGG - Intergenic
991994157 5:72370755-72370777 TAAGGGATAGAGAGGAGGAAAGG - Intergenic
992451430 5:76879731-76879753 TAAGTGATACAAAAGAGGCATGG + Intronic
992575591 5:78107430-78107452 AAAGAGAGAGAGAGGGAGCATGG - Intronic
992743152 5:79793962-79793984 TAAGAGATAGGGAAGAGGGAGGG + Intronic
992987010 5:82241159-82241181 TAAGAAAAAGAGAAGAGCCAAGG - Intronic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993854369 5:93055164-93055186 TAATAGATAGAGATGGAGAATGG - Intergenic
994469809 5:100188693-100188715 TAAATGATAGAGATGGAGCAGGG + Intergenic
994530844 5:100968480-100968502 TAATAGATAGAGGAGATGCAAGG + Intergenic
994621960 5:102174449-102174471 TAAGTGACAGAGAAGAGGCCTGG - Intergenic
995417117 5:111924201-111924223 TAAGAAATTGAGAAGGGCCTTGG + Intronic
995673635 5:114636523-114636545 TGAGAGAGAGAGAAGAGGGAAGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996646944 5:125828240-125828262 AAAGAGTTAGGGAAGGGGAAGGG - Intergenic
997264224 5:132485797-132485819 AGAGAGACAGAGAAAGGGCAGGG - Intronic
997404916 5:133638109-133638131 TGAGAGAAAGAGAAGAGCCAAGG - Intergenic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997973301 5:138422339-138422361 TAAAAGATAGAAAAGAGGCTGGG + Intronic
998076219 5:139238638-139238660 TAAGAGAAAGAAAGGGGTCAGGG + Intronic
998285809 5:140859765-140859787 TAAGAGCTGGAGACAGGGCATGG - Intronic
998641680 5:144018647-144018669 TAACTGCTAGAAAAGGGGCAGGG + Intergenic
998763969 5:145464127-145464149 GAAGACGTACAGAAGGGGCATGG - Intergenic
999054428 5:148558706-148558728 TAAGAAATAGAGTGGGGGGAAGG - Intronic
999214172 5:149917912-149917934 TAAGAGAGAACAAAGGGGCAGGG - Intronic
999324301 5:150633735-150633757 TCAGAGATAGAGACAGAGCAAGG - Intronic
999414862 5:151386171-151386193 AAAAAGATACAGAAGGGGCCGGG - Intergenic
999649148 5:153748593-153748615 TAAGAACAAGAGAAGAGGCAAGG + Intronic
999889268 5:155959019-155959041 TAAGACATAGAGAGGAGGAAAGG - Intronic
1000253479 5:159516647-159516669 GAAGAGATAGAGAGAGGGAACGG - Intergenic
1000336975 5:160248747-160248769 TAAAAGATAGGGAAGAGGCTGGG + Intergenic
1000839936 5:166205548-166205570 AAAGAGAGAGGGTAGGGGCAGGG + Intergenic
1001563104 5:172683088-172683110 AAAGAGGGAGAGAAGGGGAAAGG + Intronic
1001780579 5:174365481-174365503 TAAGAGTTGGAGAAGTGGAAGGG + Intergenic
1002379303 5:178814226-178814248 TGAGAGGGAGAGAAGGGGGATGG - Intergenic
1003384638 6:5655855-5655877 TCAGAGACAGAGATGGGGAAAGG - Intronic
1003482906 6:6549400-6549422 TTAGAACTAGAGAAGGGGCTGGG - Intergenic
1003783005 6:9450496-9450518 TAAGTGATAGAGATAGGGTACGG - Intergenic
1003792690 6:9564750-9564772 TTAGAGATAGAGTAGCGGCTAGG - Intergenic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004343584 6:14828478-14828500 TAAGAGAGAGCAAATGGGCAAGG + Intergenic
1004506052 6:16247663-16247685 TAAGAGATACAGGCCGGGCATGG - Intronic
1007407965 6:41645582-41645604 AGAAAGATAGAGATGGGGCAGGG - Intronic
1007608806 6:43135498-43135520 CAAGTGATAGAGAAAGGGCAGGG + Intronic
1007927025 6:45658055-45658077 TGAGGGAAAGAGAAGGGTCAAGG + Intronic
1008144018 6:47867691-47867713 TAATAGATAGAGATGGAGGATGG - Intergenic
1008350515 6:50484287-50484309 AAAGAGACAGAGAAGGAACAGGG + Intergenic
1008577674 6:52876809-52876831 CAAGATATGGGGAAGGGGCATGG + Intronic
1008776193 6:55040925-55040947 TAAGAGAAAAAGAAGAGTCAGGG + Intergenic
1008779010 6:55079001-55079023 AAAGAGAGAGGGAGGGGGCAAGG - Intergenic
1009543696 6:64999446-64999468 TAAATGATACAGAAGGGGGAAGG + Intronic
1010270696 6:73913715-73913737 TCAGAAGTAGGGAAGGGGCAAGG + Intergenic
1010646228 6:78390420-78390442 AAAGAGATAGGGAAGAAGCATGG + Intergenic
1010824577 6:80456529-80456551 TAAGTGATGGAGAAGCGGAAAGG - Intergenic
1011097209 6:83679531-83679553 GAAGAGATAGGGATGGGGCCTGG - Intronic
1012153321 6:95783557-95783579 CAGGAGAGAGAGAAAGGGCAGGG + Intergenic
1012538408 6:100328000-100328022 TAAGAAAGAGAGAAAGGGAAAGG - Intergenic
1013092631 6:106914067-106914089 TGAAAGATAGAGAAGGCCCAGGG - Intergenic
1013343274 6:109236198-109236220 TTAGGGATAGAAAAGGGGGAAGG + Intergenic
1013525896 6:110973715-110973737 TAAAAAATAGAGAAGGGGTTTGG + Intergenic
1013814421 6:114080784-114080806 TAGGAGGGAGAGAAGGGGCAAGG + Intronic
1013922671 6:115427377-115427399 TAATTGATAGAGCAGTGGCAGGG - Intergenic
1014348543 6:120308773-120308795 TAAAAAATAGAGGAGGGGCCGGG - Intergenic
1014380770 6:120738493-120738515 AGAGAGGAAGAGAAGGGGCAGGG - Intergenic
1014886093 6:126783414-126783436 TGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1015436997 6:133200896-133200918 TGAAAGATAAAGAAGTGGCAGGG + Intergenic
1015633392 6:135253165-135253187 TAAGAGGGGAAGAAGGGGCAGGG - Intergenic
1015882450 6:137882621-137882643 GATGAGATAGGGAAGGAGCAGGG + Exonic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1016674876 6:146752248-146752270 TAAGAGAGAGAGAAAGGGGGAGG + Intronic
1016861215 6:148720630-148720652 TAAGAGAAAAAGAAGGAGCGTGG - Intergenic
1017094964 6:150796735-150796757 TATGAAATGGGGAAGGGGCAGGG - Intronic
1017291411 6:152742956-152742978 TATTAGATAGAGAAGGCACAGGG - Intergenic
1017334899 6:153244719-153244741 TGAAAGATAGAGAAGGGAGAAGG - Intergenic
1017354726 6:153490316-153490338 TAAGATAAAGAGACGGGGCCGGG + Intergenic
1017552147 6:155520477-155520499 CAAGAGTTAGAGAAGCAGCAGGG - Intergenic
1017633860 6:156424413-156424435 TGAGAGAAAGAGAAGAGTCAAGG - Intergenic
1018438484 6:163785615-163785637 TAGGACATATAGAAGGGGAAAGG + Intergenic
1018751114 6:166807474-166807496 GAAGAGATGGAGAGGGAGCAGGG - Intronic
1019194101 6:170271362-170271384 TCAGAGACAGGGAAGGGGCCAGG - Intergenic
1020959119 7:14780034-14780056 TAAGATGTAGAAATGGGGCATGG + Intronic
1021514361 7:21466653-21466675 TAAGAGATACAGAAGGTACTCGG + Intronic
1022481125 7:30743826-30743848 TAAGAGAGAGAGAAGAGTCAAGG - Intronic
1023149054 7:37182577-37182599 GAAGAGAGAGAGGAGGGGGAGGG - Intronic
1023463100 7:40421930-40421952 TAAGGGAAAGAGTTGGGGCAAGG - Intronic
1023579324 7:41664449-41664471 TAAAAGATGGCGAAGGGGCAAGG + Intergenic
1024133301 7:46379470-46379492 AGAGAGATAGAGATGGGGAATGG - Intergenic
1024217513 7:47259875-47259897 AAAGAGATAGAGAAGGTGAGAGG - Intergenic
1025851547 7:65248703-65248725 TGAGGGAAAGAAAAGGGGCAAGG + Intergenic
1025873851 7:65461470-65461492 TAAGAGTTTGGGAAGGGGAAGGG + Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026264620 7:68785373-68785395 AAAAAGATAGGGAATGGGCATGG + Intergenic
1026729388 7:72898076-72898098 TAAGAGAAAGAGAGGAGTCAAGG + Intronic
1027114614 7:75469035-75469057 TAAGAGAAAGAGAGGAGTCAAGG - Intronic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1027256538 7:76434341-76434363 TAAGAGGTAGAGGCCGGGCACGG + Intronic
1027282356 7:76617975-76617997 TAAGAGGTAGAGGCCGGGCACGG - Intronic
1027410550 7:77913095-77913117 AAAGAGATAGAGGCTGGGCACGG + Intronic
1027488000 7:78786170-78786192 TGAGAGACAGAGAGGAGGCAAGG - Intronic
1027567284 7:79811653-79811675 TAAGAGGTAGAGAAAGGAAAAGG - Intergenic
1027943622 7:84717601-84717623 AAAGAGTTAGAGAAGGAGAAGGG + Intergenic
1028164518 7:87522448-87522470 TAAGAGCCAGAGAAGTGACAGGG + Intronic
1028415331 7:90574391-90574413 GAAGAGAGAAAGGAGGGGCATGG + Intronic
1028539292 7:91924712-91924734 TAAGAGAAACAGAAGAGACAAGG + Intergenic
1029021723 7:97371316-97371338 GGAGTGATAGAGAAGGGGTAGGG + Intergenic
1029358710 7:100072377-100072399 AAGGAGACAGGGAAGGGGCAGGG + Intronic
1030235354 7:107253932-107253954 TAAAGGATAGAGAATGGGGATGG - Intronic
1030378571 7:108783599-108783621 GAAGAAATAGAGAAGTGTCAGGG + Intergenic
1030400988 7:109049848-109049870 TAAGAGGTAGAAAAAGGGCTTGG + Intergenic
1030594151 7:111516378-111516400 GAAGAGAGAGAGAAGAGGGAGGG + Intronic
1031857325 7:126938182-126938204 GAAGGGACAGAGAAGGGGAAGGG - Intronic
1031970617 7:128062399-128062421 AAAAGGAAAGAGAAGGGGCAAGG + Intronic
1032355953 7:131210719-131210741 AAAGAGAGAGAGAAAGGGGAAGG + Intronic
1032480414 7:132241659-132241681 GAAGAGAAAGAGAAGGGTCTTGG - Intronic
1033572200 7:142641683-142641705 TAAGAGAGAGAGAGAGGCCAAGG - Intergenic
1033618782 7:143042922-143042944 TCAGAGATAAAGAAAGGCCAAGG - Intergenic
1034365405 7:150542141-150542163 CAAGAGAGAGAGAATGGGTAGGG + Intergenic
1035319835 7:158021711-158021733 TCAGAGATCGAGGTGGGGCAGGG - Intronic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1035791758 8:2312701-2312723 AAAGAGAGAGACAGGGGGCATGG + Intergenic
1035801047 8:2409004-2409026 AAAGAGAGAGACAGGGGGCATGG - Intergenic
1036933906 8:12982239-12982261 GAGGTGATAGGGAAGGGGCAGGG + Intronic
1037104002 8:15082468-15082490 TAAGAGAGAGAAATGGGGGAGGG + Intronic
1037899188 8:22677611-22677633 AGAGAAATAGAGAAGGGGGAGGG + Intergenic
1038188223 8:25294856-25294878 TAAGAGAGAGAGAGGTGGGAGGG + Intronic
1039567623 8:38562806-38562828 TAACAGAAAGGGAAGGGGAAAGG - Intergenic
1039755702 8:40519528-40519550 TATGAGAAAGAGAAGAGGCTGGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041177414 8:55210812-55210834 TAAGAAATTGACAGGGGGCAGGG + Intronic
1041759196 8:61345753-61345775 AAAGAGGTAGAGAAGAGGAAAGG + Intronic
1042059823 8:64804235-64804257 TCAGAGCTAGACAAGGGCCATGG - Intergenic
1042251445 8:66759878-66759900 TAAGAGACAGAAGAGGGGCTGGG - Intronic
1042514473 8:69644982-69645004 CAAGAGATGGAGCAGGGGCAGGG + Intronic
1043000473 8:74753732-74753754 TTAGAAAAAGTGAAGGGGCATGG - Intronic
1043262260 8:78217054-78217076 GAAGAGGGAAAGAAGGGGCAGGG + Intergenic
1043576613 8:81666130-81666152 AAAGAGAGAGAAAAGGGGAATGG + Intronic
1044346090 8:91106012-91106034 TAAAGCAGAGAGAAGGGGCAGGG + Intronic
1044492882 8:92841412-92841434 TATGAGAGAGAGATGGTGCAAGG - Intergenic
1044520873 8:93197950-93197972 TAAGGAATAGAAAAGGGACAAGG - Intergenic
1044527495 8:93267969-93267991 TAAGAAATAGAAAAGAGGCCAGG - Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1045423874 8:102043692-102043714 GAGGAGGAAGAGAAGGGGCAGGG + Intronic
1045654215 8:104370044-104370066 TGAGAGAAAGAGAGAGGGCAGGG + Intronic
1045763783 8:105643405-105643427 AAAGAGAGAGAGAAGGGTAATGG - Intronic
1045985098 8:108240691-108240713 TAAGAAATAGGCCAGGGGCAAGG + Intronic
1047068568 8:121316040-121316062 TAAGACAGTGAGAAGGGGAAGGG - Intergenic
1047394924 8:124488442-124488464 TACGAGAAAAAGAAGGGGAATGG + Intergenic
1047479880 8:125271435-125271457 TAAGAGACAGAGTAGAGTCAAGG + Intronic
1047548946 8:125848804-125848826 GAAGAGCTAGAAAATGGGCAGGG - Intergenic
1047564108 8:126022882-126022904 GAAGACATAGAGAAGGAGAATGG + Intergenic
1048040983 8:130728522-130728544 TGAGAGAAGGAGAAGGGTCAGGG + Intergenic
1048381853 8:133872185-133872207 TGAGTGGAAGAGAAGGGGCAAGG + Intergenic
1048504761 8:135011069-135011091 TTAGTAATAGAGAAGGGGCTAGG + Intergenic
1048528504 8:135226396-135226418 TGAGATATGGAGTAGGGGCAAGG + Intergenic
1048729377 8:137420462-137420484 AAAGAGAGAGAGAAGGGGGGGGG - Intergenic
1050044142 9:1526018-1526040 GATGAGGAAGAGAAGGGGCAGGG - Intergenic
1050663390 9:7908461-7908483 TGAGAGATAGGGAAGAGGAAAGG + Intergenic
1051123965 9:13782939-13782961 TAGTTGATAGAGCAGGGGCAGGG + Intergenic
1051453608 9:17226867-17226889 CAAGAGAGAGAGACAGGGCATGG + Intronic
1051480417 9:17554036-17554058 AAAGAGAGAGAGAAAGGGGAGGG - Intergenic
1052226364 9:26093120-26093142 GAAGAGAGAGAGCAGGAGCAGGG - Intergenic
1052359732 9:27541059-27541081 TAAAAGTTAGAGGAGGGGCCTGG + Intergenic
1052432524 9:28385474-28385496 TAAGAAATATAGAAAAGGCACGG + Intronic
1052509809 9:29401312-29401334 GGTGAGAGAGAGAAGGGGCAAGG + Intergenic
1052518307 9:29511301-29511323 CAAGAGAGAGAGCAGGTGCAGGG + Intergenic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1054885050 9:70187607-70187629 GAAGAGATAGGGAAAGGGAATGG - Intronic
1055666788 9:78560981-78561003 TAAGAGAGAGAGGAGGTGCCAGG + Intergenic
1055880978 9:81002825-81002847 GAAGTGATAGATAATGGGCATGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056422539 9:86443464-86443486 TAAGAAATCAAGGAGGGGCAAGG - Intergenic
1056689033 9:88790244-88790266 TGAGAGACAGAGAAGGGGCAAGG + Intergenic
1057056487 9:91965602-91965624 TAAGAGAAAGGGAAGAGTCAAGG - Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057079867 9:92165354-92165376 TAAGACATAGAGAAAGGGGAAGG + Intergenic
1057189722 9:93079947-93079969 TAAGAGAGAGAGAAAGGAGAGGG - Intronic
1057515706 9:95718700-95718722 TAAAAGATAGACAAGGGAAATGG - Intergenic
1057906980 9:98990733-98990755 ACAGAGATAGAGAAGTGGGAGGG + Intronic
1058373090 9:104292922-104292944 TATGGGACAGAGAAGGGTCAAGG - Intergenic
1058889274 9:109346944-109346966 TAGGAGAAAGAGAAGAGGCAAGG + Intergenic
1059048047 9:110892666-110892688 AAAGAGAGAGAGAGGGGGAAGGG + Intronic
1059198052 9:112389352-112389374 TAAGATATAGAGAAGGAGAAAGG + Intronic
1059466579 9:114472497-114472519 GCAGTGTTAGAGAAGGGGCAGGG - Intronic
1059616238 9:115954325-115954347 TAAGAGCTAGAAAAGAAGCAAGG - Intergenic
1059986727 9:119827650-119827672 CATCAGAGAGAGAAGGGGCAGGG + Intergenic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1060294677 9:122335368-122335390 CAAGAGATAGAGGAGAGGAAGGG - Intergenic
1060498458 9:124134849-124134871 GAAGAGATAGAGATGGGGTGGGG - Intergenic
1061035709 9:128113288-128113310 AAAGAAATAGAGAAGGGGCCAGG + Intergenic
1061121718 9:128647335-128647357 TCAGAGAAAGAAATGGGGCATGG + Intronic
1061751871 9:132784148-132784170 AAAGAGAAAGAGAAGGGGGTAGG + Intronic
1062130956 9:134892801-134892823 TGAGGGGTAGGGAAGGGGCAGGG - Intergenic
1062449130 9:136608233-136608255 GAAGAGAGAGGGAAGGGGAAAGG + Intergenic
1185494832 X:546369-546391 AGAGAGAGAGAGAAGGGGCTGGG + Intergenic
1185756304 X:2655724-2655746 CAAGAGATAGAGAAGGTGAGAGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185879923 X:3731904-3731926 TAAGAGATGCAGAAGGCCCAAGG + Intergenic
1186074079 X:5857406-5857428 TGCGAGAGAGAGAAGGGGGAAGG + Intronic
1186077585 X:5897909-5897931 TAAGAGAGAGAAAAGAGGGAAGG - Intronic
1186255889 X:7719116-7719138 TAATTGATAAAGAAGTGGCAGGG - Intergenic
1187342784 X:18436279-18436301 GAAGAGGTAGAGAAGGTGGAAGG + Intronic
1187418086 X:19110836-19110858 AGAGAGATAGAAGAGGGGCAGGG + Intronic
1187467646 X:19541205-19541227 TTAGAAGTAGAGAATGGGCATGG - Intronic
1187888570 X:23912244-23912266 GAAGAGATAAAGAAAGGGCCGGG - Intronic
1188089137 X:25940603-25940625 AGAGAGATAAGGAAGGGGCAGGG - Intergenic
1188138253 X:26516356-26516378 GAAGAGGTAGAGAAGGTGGAAGG - Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1189173709 X:38933526-38933548 TAATAGAGATAGAAGTGGCAAGG + Intergenic
1189313872 X:40039898-40039920 TAAGAGATGGGGAAGGAGAAAGG + Intergenic
1189840306 X:45068847-45068869 AAAGAGAGAGAGAAAGGGAAAGG - Intronic
1191770167 X:64747042-64747064 CAAGAGAGAGTGAAGGGGGAGGG + Intergenic
1192244220 X:69359726-69359748 AGAGAGACAAAGAAGGGGCAGGG - Intergenic
1192796798 X:74430334-74430356 TAAGACATAGTGAAGGTGTAGGG + Intronic
1193239711 X:79153535-79153557 TTAGAGAGAGAGATGGGGAACGG + Intergenic
1193360571 X:80574453-80574475 AAGGAGATAGAGAAAGGGCTTGG - Intergenic
1194313049 X:92338818-92338840 TTAGAAATAGAGAAGAAGCAAGG - Intronic
1194528652 X:95014756-95014778 AAAGAGACAGAGAAGGGATAGGG + Intergenic
1194841623 X:98751482-98751504 TATGAGATTTAGGAGGGGCAGGG - Intergenic
1195822233 X:108957480-108957502 AGAGAGACAGAGAATGGGCAGGG - Intergenic
1196096513 X:111806551-111806573 TAAGAGAGAGAGAAAAGCCATGG + Intronic
1196196019 X:112839720-112839742 GAAGAGAAAGAAAAGGGGGAGGG - Intronic
1196402905 X:115334511-115334533 TAAGAAATAGTTAAGGGGCCGGG + Intergenic
1196488226 X:116238918-116238940 AATGAGATAGAGAAGGGGAAAGG - Intergenic
1196509823 X:116495844-116495866 CAAGAGATAGAGAATAGGCTGGG - Intergenic
1197436508 X:126434838-126434860 GAGGAGATAGAGGAGGGGGAAGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197859237 X:130951406-130951428 TGAGAGAAAGAGAAGTGTCAAGG - Intergenic
1197878665 X:131140453-131140475 ATAGAGAGAGAGAAGGGGAAGGG + Intergenic
1197966892 X:132073730-132073752 GAAGAGATATAGCAGGGTCAAGG - Intergenic
1198074409 X:133180771-133180793 TAGGAGAGAGAGAAGAGGCTTGG - Intergenic
1198420102 X:136463158-136463180 TAAGAGATTGGGTAGTGGCAGGG + Intergenic
1198518662 X:137431174-137431196 ATAGAGATAGAGAGGGAGCAGGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198875197 X:141217208-141217230 TAAGAAACACAGAAGGGGCCGGG + Intergenic
1198999692 X:142620153-142620175 AAAGGGAGAGAGAAGGGGAAAGG + Intergenic
1199866339 X:151853295-151853317 TAAGAGAAAGGGAAGTGGCCTGG + Intergenic
1200621316 Y:5452932-5452954 TTAGAAATAGAGAAGAAGCAAGG - Intronic
1201604107 Y:15766164-15766186 GAAGAGGGAGAGAAGGGGAAGGG - Intergenic