ID: 913070620

View in Genome Browser
Species Human (GRCh38)
Location 1:115295178-115295200
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913070620_913070626 -5 Left 913070620 1:115295178-115295200 CCAACCACGAAGAGGAGTTGGAG No data
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913070620 Original CRISPR CTCCAACTCCTCTTCGTGGT TGG (reversed) Intronic
No off target data available for this crispr