ID: 913070626

View in Genome Browser
Species Human (GRCh38)
Location 1:115295196-115295218
Sequence TGGAGAATGGGGAGGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913070614_913070626 12 Left 913070614 1:115295161-115295183 CCATCGCTCCCCAAATTCCAACC No data
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070620_913070626 -5 Left 913070620 1:115295178-115295200 CCAACCACGAAGAGGAGTTGGAG No data
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070615_913070626 4 Left 913070615 1:115295169-115295191 CCCCAAATTCCAACCACGAAGAG 0: 1
1: 0
2: 2
3: 8
4: 115
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070616_913070626 3 Left 913070616 1:115295170-115295192 CCCAAATTCCAACCACGAAGAGG No data
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070613_913070626 15 Left 913070613 1:115295158-115295180 CCACCATCGCTCCCCAAATTCCA 0: 1
1: 0
2: 2
3: 31
4: 243
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070621_913070626 -9 Left 913070621 1:115295182-115295204 CCACGAAGAGGAGTTGGAGAATG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data
913070618_913070626 2 Left 913070618 1:115295171-115295193 CCAAATTCCAACCACGAAGAGGA 0: 1
1: 0
2: 3
3: 13
4: 163
Right 913070626 1:115295196-115295218 TGGAGAATGGGGAGGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913070626 Original CRISPR TGGAGAATGGGGAGGTAGCA AGG Intronic
No off target data available for this crispr