ID: 913072341

View in Genome Browser
Species Human (GRCh38)
Location 1:115311008-115311030
Sequence TAGAATACCTACTTTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913072341_913072346 10 Left 913072341 1:115311008-115311030 CCACATGCAAAGTAGGTATTCTA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 913072346 1:115311041-115311063 ACAAGGGAGTTGAGACTGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 257
913072341_913072344 -7 Left 913072341 1:115311008-115311030 CCACATGCAAAGTAGGTATTCTA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 913072344 1:115311024-115311046 TATTCTATTTTGGGCAAACAAGG No data
913072341_913072345 -6 Left 913072341 1:115311008-115311030 CCACATGCAAAGTAGGTATTCTA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913072341 Original CRISPR TAGAATACCTACTTTGCATG TGG (reversed) Intronic
901586597 1:10299829-10299851 TAGGAGGCCTACTTTGCATTTGG + Intronic
903374090 1:22854890-22854912 TATAAAAGCCACTTTGCATGAGG + Intronic
904597559 1:31656419-31656441 TAGAATCCCTGCTTTCCAGGGGG + Exonic
905920793 1:41717277-41717299 TTGAATACCTACTTTGTGTCAGG + Intronic
908727734 1:67194802-67194824 TTGAATTCTTACTTAGCATGAGG + Intronic
909030279 1:70531054-70531076 TGGAGTACCTATTTTCCATGAGG + Intergenic
909102765 1:71370833-71370855 TACTATACCCACTTTGCAGGTGG - Intergenic
909584087 1:77270075-77270097 GAGAATACCTATTTAGCATGAGG + Intergenic
910132846 1:83929518-83929540 TAAAAAACCTAAATTGCATGGGG - Intronic
910843342 1:91582525-91582547 TAGACTTCCTACTTTTCATGGGG + Intergenic
912580187 1:110714148-110714170 TTAAATACCTACTGTGCATCAGG - Intergenic
912992079 1:114498232-114498254 TAAAATACATATTTTGCCTGGGG + Intronic
913062533 1:115221337-115221359 TTTAAAACCTACTTTGCATATGG - Intergenic
913072341 1:115311008-115311030 TAGAATACCTACTTTGCATGTGG - Intronic
916749142 1:167708652-167708674 TTGAATACCTACTATGTCTGAGG - Intergenic
918323702 1:183389555-183389577 TTTAATACCTACTTTGCACAAGG - Intronic
920400452 1:205672968-205672990 TAAAATCCCTACTTTGTATTTGG + Intronic
922038051 1:221869157-221869179 TTGCATACTTCCTTTGCATGTGG + Intergenic
922308353 1:224364390-224364412 TTGAGTGCCTACTTTGCATGTGG + Intronic
922419313 1:225448811-225448833 TAGAATTCCTACTCTGAAGGTGG - Intergenic
923273032 1:232374363-232374385 TCAAATACCTACATTGCATGAGG + Intergenic
923982585 1:239341839-239341861 TAGAAAACGTACTTGACATGGGG - Intergenic
1063544395 10:6966355-6966377 CTGAATACCTATTTTGCATAAGG + Intergenic
1064667812 10:17674783-17674805 TGGAATACATAATTTGCCTGAGG + Intronic
1064947647 10:20809085-20809107 TAGAATTCCTGCTTTGCCTTGGG + Intronic
1065258737 10:23902504-23902526 TAGGATGCATTCTTTGCATGTGG + Intronic
1067026108 10:42845568-42845590 TGGAATACACACTTTGCATATGG - Intergenic
1067163859 10:43849248-43849270 AAGAACACCCACTTTGCATAGGG - Intergenic
1067744985 10:48928889-48928911 TTGAAAACCTACTATGAATGAGG + Intronic
1067895228 10:50171831-50171853 AAGAATAGCTACTCTGGATGGGG - Intergenic
1067953755 10:50770147-50770169 AAGAATAGCTACTCTGGATGGGG + Intronic
1068084236 10:52354967-52354989 TTGAAAATCTATTTTGCATGAGG + Intergenic
1068864003 10:61875827-61875849 AAAAATACCTACTTTGCAGAAGG + Intergenic
1069252372 10:66285283-66285305 TAGAAAACCTACTCTGCCAGAGG - Intronic
1071389902 10:85162754-85162776 TAGAATACTTACTTAACAGGCGG + Intergenic
1078647673 11:13156985-13157007 TTGAATACCTACTATGTATCAGG - Intergenic
1084036241 11:66512605-66512627 TTGAATACCTAGTTTGTATTTGG + Intronic
1086727500 11:90206203-90206225 TGGAGTACCTATTTTCCATGAGG - Exonic
1087249313 11:95878423-95878445 TAAAATACATAGTTTGCATTAGG - Intronic
1088732663 11:112696910-112696932 TTGAATACCTACTGTGTATTGGG - Intergenic
1089404015 11:118182572-118182594 GTGAATATCTACTTTGCATCTGG + Intergenic
1091736091 12:2923238-2923260 TTGGGTACCTACTTTGCATTAGG + Intronic
1093240653 12:16667525-16667547 GAGAATACCTAGTTTCCATGTGG - Intergenic
1093800118 12:23362822-23362844 TAGAATAGCTAATTTAGATGGGG + Intergenic
1094445827 12:30528859-30528881 ACAAATACCTAATTTGCATGCGG + Intergenic
1095580520 12:43792003-43792025 TAGAATACCTAAGTGCCATGAGG + Intergenic
1098477595 12:70922567-70922589 TTGAGTATCTATTTTGCATGAGG - Intergenic
1099771251 12:87060487-87060509 TAGAATACCTAATTTGTAAATGG + Intergenic
1100728265 12:97433808-97433830 TGGAGTACCTACTATGTATGTGG - Intergenic
1100738588 12:97565809-97565831 TAGAAAACTTTCTTTACATGAGG - Intergenic
1101019347 12:100537107-100537129 TAGATTACCTATTTTACATACGG + Intronic
1102222825 12:111205899-111205921 TAGAATGCCTACTGTGTATCAGG + Intronic
1103982455 12:124745522-124745544 TGGAGTACCTACTGTGCGTGAGG - Intergenic
1106135581 13:26971000-26971022 AAGAATACTTACTTTACAGGTGG - Intergenic
1110022748 13:70495580-70495602 TTGAACACCTGCTATGCATGTGG + Intergenic
1111764394 13:92509527-92509549 TAGAATGTCTCCTTTGCATGAGG - Intronic
1114732702 14:25010729-25010751 TATACTACATGCTTTGCATGTGG + Intronic
1116783405 14:49262017-49262039 TATAATTCCTGCTTTGCTTGGGG + Intergenic
1123179767 14:106459053-106459075 TAAAAAACCTACTTTGCACCAGG + Intergenic
1125525536 15:40371758-40371780 TTGAACACCTACTTTGCATATGG + Intergenic
1130768946 15:86904462-86904484 TAGAATGCTTACATTGCATTTGG + Intronic
1134684678 16:16150338-16150360 TAGAAGTCCTGCTTTCCATGCGG + Intronic
1137986973 16:53117353-53117375 TAGAATACAGACTATTCATGTGG + Intronic
1141183397 16:81770016-81770038 TTGAATATCTACCTTGCATCAGG - Intronic
1143223465 17:5281508-5281530 TAAACTACCTCCTTGGCATGGGG + Intergenic
1144839968 17:18179940-18179962 TTAAATACCTACTGTGAATGAGG + Intergenic
1145858336 17:28184296-28184318 TAGTTTACATGCTTTGCATGTGG + Intronic
1148624173 17:49056234-49056256 AAAAATGCCTACTTTGCATTTGG - Intergenic
1149768899 17:59304364-59304386 TTGAATACCTACTATGTATTTGG + Intergenic
1151023038 17:70641729-70641751 TAGAGTATCTATTTTGCATTTGG + Intergenic
1153231895 18:2945980-2946002 TGGAGTACCTATTTTCCATGAGG - Intronic
1153923156 18:9808967-9808989 TAGAACACCTACTCTGCCTCAGG - Intronic
1154259046 18:12812979-12813001 TAGAATACATACTTTATCTGAGG - Intronic
1155545076 18:26906547-26906569 TAGAATACCTACCTAGTAAGGGG - Exonic
1156473636 18:37392589-37392611 TAGCATCTCTACTTTGCTTGTGG - Intronic
1157999938 18:52606401-52606423 TAGAATACCTACTTTGTACTAGG - Intronic
1162374916 19:10299196-10299218 TTGAACACCTACTATGCATCAGG + Intergenic
1168368149 19:55807162-55807184 AAGAATGCCTACTTTGTTTGAGG - Intronic
925284590 2:2707423-2707445 TAGAACAGCTCATTTGCATGAGG + Intergenic
926922693 2:17954849-17954871 ATGGATACCTCCTTTGCATGTGG + Intronic
927432605 2:23039977-23039999 CAGAATATCTACTCAGCATGTGG + Intergenic
928524292 2:32123815-32123837 TAGATTAACTTTTTTGCATGTGG - Intronic
929541513 2:42826756-42826778 TGGAGTACCTATTTTCCATGAGG - Intergenic
930382021 2:50642166-50642188 TTAAAGACCTACTATGCATGAGG + Intronic
931532416 2:63231146-63231168 ATGAATACCTAGTTTACATGTGG - Intronic
931842364 2:66167545-66167567 TAGAATACCTGTATTGCATGGGG - Intergenic
933223862 2:79722776-79722798 TTGATCACCTACTTTGCCTGTGG - Intronic
939569544 2:143824455-143824477 TAGATTCACTACTTAGCATGGGG + Intergenic
939739772 2:145891992-145892014 TAGAATACATATTTTGAATGGGG - Intergenic
939907493 2:147935059-147935081 TAGAATCCAAAATTTGCATGTGG + Exonic
940827239 2:158426673-158426695 AAGATTAACTACTCTGCATGCGG - Intronic
941252349 2:163181729-163181751 AAGGCTACCTACTTTGCATGGGG + Intergenic
942632793 2:177969845-177969867 TTGAATATCTACTATGCATTTGG + Intronic
942703495 2:178740732-178740754 TAGAATACCTTCTTTGGAGAAGG + Exonic
945473523 2:210254757-210254779 TTGAGTACCTACTTTGTGTGAGG + Intergenic
1169712871 20:8584260-8584282 CAGAATTCCTACTTTGTGTGAGG - Intronic
1173999921 20:47367075-47367097 TAGTATTCCTATTTTACATGTGG - Intergenic
1177805895 21:25874408-25874430 TATAATAAATACTTTTCATGTGG + Intergenic
1178169460 21:30022960-30022982 TCGAATACATTCTTTGCATTTGG - Intergenic
1179448297 21:41449425-41449447 TTGAATACCAACTTGGCATCTGG - Intronic
1180130476 21:45823705-45823727 AAAAACACCTACTTTGCCTGGGG - Intronic
1180914425 22:19475382-19475404 AACAGTACTTACTTTGCATGTGG - Intronic
1181900913 22:26155059-26155081 TATAATACCTACTATGCACCAGG - Intergenic
1182998004 22:34832086-34832108 AATAATACCTACTTTGAATCAGG + Intergenic
951463928 3:22980753-22980775 TAGAATTCTTACTTTGCCTTTGG - Intergenic
952320401 3:32271918-32271940 TAGAATGCCTAATTTGTAGGTGG - Intronic
954802421 3:53194834-53194856 TCAAATACCTACTTGGCAGGTGG - Intergenic
955836981 3:63066744-63066766 TAGAATGCTTACTGTGCATCAGG - Intergenic
957619442 3:82575789-82575811 TTGAATACCTACTTTGTGTTTGG - Intergenic
958990699 3:100840987-100841009 TAGAAAAGAAACTTTGCATGTGG - Intronic
960356096 3:116655364-116655386 ATAAAAACCTACTTTGCATGGGG - Intronic
962175373 3:133148350-133148372 TATAATAGCTACTTTTCTTGGGG + Intronic
966339920 3:178914349-178914371 TAGAAAATGTACTGTGCATGGGG - Intergenic
967331270 3:188292172-188292194 TACAATTCCTTTTTTGCATGAGG + Intronic
967764619 3:193264912-193264934 TAGAATACATATTTTTCATCAGG + Intronic
970033167 4:11701008-11701030 TACAATACTTACTTTCCAGGAGG - Intergenic
973122706 4:46542684-46542706 TAGAATACCTACTTTGTGCCAGG - Intergenic
973673997 4:53245668-53245690 TTCAATACCTAGTTTGTATGAGG - Intronic
976959583 4:90952597-90952619 TAGAATTCCTTTTTTGCCTGAGG + Intronic
977258639 4:94769946-94769968 TAGAATACCCACTTTGGTTGAGG - Intronic
980548401 4:134301057-134301079 TTTAGTACCTACTATGCATGAGG + Intergenic
980948335 4:139346341-139346363 TTGAATACCTACTTTGAGTTAGG + Intronic
982971163 4:161989038-161989060 TAGAATACATCCTTGGCATAGGG - Intronic
984521234 4:180803639-180803661 TTGAATACGTTCTGTGCATGTGG + Intergenic
984641153 4:182165597-182165619 TAGAAAACCAACTTTCCATCAGG + Intronic
984678378 4:182577350-182577372 TAGAATACCTACTGTACTTCAGG - Intronic
984708020 4:182862079-182862101 TTGAGCACCTACTTTGCATGAGG + Intergenic
986809513 5:11340826-11340848 TATAATACCTATTTTACATGTGG - Intronic
986829332 5:11558865-11558887 GAGAATACTTACCTTGCAAGTGG + Intronic
987778698 5:22403263-22403285 TAGAATATTCACTTTACATGTGG + Intronic
991133454 5:63153726-63153748 TATAATGCCTAATTTGCCTGAGG + Intergenic
992836234 5:80644318-80644340 TTGAATTCCTACTTTGCTAGGGG + Intronic
995047333 5:107667935-107667957 TAAAATACTTATTTGGCATGTGG + Intronic
995305351 5:110640268-110640290 TACAAAACCTAATTTACATGGGG + Intronic
996372097 5:122764201-122764223 TAGGATAACCACTTTGGATGGGG - Intergenic
999008826 5:148012083-148012105 CATAATACCTAATGTGCATGTGG - Intergenic
999953556 5:156676211-156676233 TTGAGTACCTATTTTTCATGTGG + Intronic
1002941257 6:1718334-1718356 GAGAAGACTTACTTTGCAGGGGG - Intronic
1003978097 6:11363271-11363293 TTGATTAACTACTTTGCATTGGG + Intronic
1004954090 6:20707762-20707784 TTGAGTACCTACTTTATATGAGG - Intronic
1006069483 6:31487889-31487911 TCAAATACCTACTGTGCGTGGGG - Intergenic
1008524485 6:52394478-52394500 TAGAAACCATACTTTGCATTTGG + Intronic
1009504697 6:64461719-64461741 CAGAAGACCTAGTTTGAATGTGG + Intronic
1010003506 6:70971447-70971469 TGGAGAACCTACTTTGAATGTGG - Intergenic
1012389787 6:98725062-98725084 TATAATACCTACTTTACCTTTGG + Intergenic
1014178809 6:118361111-118361133 TAGATTCACTACTTTGCATGTGG - Intergenic
1015882610 6:137884223-137884245 TAGAATACATACTTGGAATTTGG - Intergenic
1018884509 6:167922489-167922511 CAGAATACCTACTTAGCAAAGGG - Intronic
1020764375 7:12302235-12302257 AAGAAAACCTTCTTTACATGAGG - Intergenic
1021050206 7:15973758-15973780 TAAAACACCTATTTTGCATATGG + Intergenic
1022071291 7:26917450-26917472 TAGAATGCCGACTTTAAATGTGG - Intronic
1023780113 7:43647523-43647545 CAGGATACTTACTTTGAATGAGG + Exonic
1026101246 7:67386280-67386302 TTGAATGCCTACTATGCATCTGG + Intergenic
1026767544 7:73169999-73170021 TTGAACACCCACTATGCATGAGG + Intergenic
1027044012 7:74979707-74979729 TTGAACACCCACTATGCATGAGG + Intronic
1027079634 7:75222651-75222673 TTGAACACCCACTATGCATGAGG - Intergenic
1027926053 7:84465348-84465370 TATAATACCTCATTTGAATGAGG + Intronic
1029388854 7:100261243-100261265 TCGAACACCCACTATGCATGAGG - Intronic
1029411894 7:100418225-100418247 TCTAATACCGATTTTGCATGTGG - Intronic
1030941472 7:115655484-115655506 TAAAATACATAAATTGCATGAGG + Intergenic
1031059052 7:117028483-117028505 TAGAACACCTAGTTTTCAGGGGG + Intronic
1031383810 7:121120904-121120926 CTGAATACCTACTTAGCATTAGG + Intronic
1031802039 7:126259119-126259141 TAGATCACATACTTTGAATGTGG - Intergenic
1034999829 7:155603882-155603904 TGGAATTCCTACTTTGCTCGTGG + Intergenic
1038106423 8:24440147-24440169 TATAATCCCCACTTTGCAGGTGG - Intergenic
1038596894 8:28895135-28895157 GAGAATACATACTCAGCATGTGG - Intronic
1045619954 8:103964850-103964872 TAGGTTCCCTATTTTGCATGTGG + Intronic
1046574612 8:116011476-116011498 TTGATTACTTACTATGCATGAGG - Intergenic
1047288683 8:123510167-123510189 TACAATACTTACTGTGCATTAGG + Intronic
1051099776 9:13507485-13507507 CAGATCACCTACTTTTCATGGGG - Intergenic
1051461650 9:17324572-17324594 TAGAATAAATACTTAGCTTGTGG + Intronic
1052089479 9:24310646-24310668 GAAAATTCCTACTGTGCATGAGG - Intergenic
1052203834 9:25814121-25814143 GAGAATACCCATTTTGCATAGGG - Intergenic
1059685943 9:116636210-116636232 TTGAATACCTACTATGTATATGG + Intronic
1187235240 X:17461036-17461058 TTGAATACCTACTTTGTGCGTGG + Intronic
1190981444 X:55459685-55459707 TTGAGTATCTACTATGCATGAGG + Intergenic
1190987254 X:55513495-55513517 TTGAGTATCTACTATGCATGAGG - Intergenic
1192196139 X:69029606-69029628 GATAATACCTACTCTACATGTGG - Intergenic
1194955285 X:100172120-100172142 TCCAATAGCTGCTTTGCATGTGG - Intergenic
1195779291 X:108443022-108443044 TATACTGCCTACTTTGTATGTGG + Intronic