ID: 913072345

View in Genome Browser
Species Human (GRCh38)
Location 1:115311025-115311047
Sequence ATTCTATTTTGGGCAAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913072341_913072345 -6 Left 913072341 1:115311008-115311030 CCACATGCAAAGTAGGTATTCTA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913072345 Original CRISPR ATTCTATTTTGGGCAAACAA GGG Intronic
No off target data available for this crispr