ID: 913082847 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:115405144-115405166 |
| Sequence | GAACAGCCAAGCAAGGAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913082847_913082852 | 22 | Left | 913082847 | 1:115405144-115405166 | CCCTCTTCCTTGCTTGGCTGTTC | No data | ||
| Right | 913082852 | 1:115405189-115405211 | TTATAATAACGTATTGATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913082847 | Original CRISPR | GAACAGCCAAGCAAGGAAGA GGG (reversed) | Intergenic | ||