ID: 913082847

View in Genome Browser
Species Human (GRCh38)
Location 1:115405144-115405166
Sequence GAACAGCCAAGCAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913082847_913082852 22 Left 913082847 1:115405144-115405166 CCCTCTTCCTTGCTTGGCTGTTC No data
Right 913082852 1:115405189-115405211 TTATAATAACGTATTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913082847 Original CRISPR GAACAGCCAAGCAAGGAAGA GGG (reversed) Intergenic