ID: 913084668

View in Genome Browser
Species Human (GRCh38)
Location 1:115425768-115425790
Sequence GTGAACACCCTATAATCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913084668_913084672 7 Left 913084668 1:115425768-115425790 CCCTAAGATTATAGGGTGTTCAC No data
Right 913084672 1:115425798-115425820 TTAGGGTCTTGTAGTGTTGAAGG No data
913084668_913084671 -10 Left 913084668 1:115425768-115425790 CCCTAAGATTATAGGGTGTTCAC No data
Right 913084671 1:115425781-115425803 GGGTGTTCACTTGTGTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913084668 Original CRISPR GTGAACACCCTATAATCTTA GGG (reversed) Intergenic
No off target data available for this crispr