ID: 913088632

View in Genome Browser
Species Human (GRCh38)
Location 1:115460918-115460940
Sequence CTCTGTCACCAGCTTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913088619_913088632 11 Left 913088619 1:115460884-115460906 CCCCCTACCTAGTTACACCCCTG No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088624_913088632 -6 Left 913088624 1:115460901-115460923 CCCCTGCATTCTTCTCCCTCTGT No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088617_913088632 16 Left 913088617 1:115460879-115460901 CCTGCCCCCCTACCTAGTTACAC No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088616_913088632 23 Left 913088616 1:115460872-115460894 CCTAGCTCCTGCCCCCCTACCTA No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088623_913088632 4 Left 913088623 1:115460891-115460913 CCTAGTTACACCCCTGCATTCTT No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088622_913088632 8 Left 913088622 1:115460887-115460909 CCTACCTAGTTACACCCCTGCAT No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088618_913088632 12 Left 913088618 1:115460883-115460905 CCCCCCTACCTAGTTACACCCCT No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088625_913088632 -7 Left 913088625 1:115460902-115460924 CCCTGCATTCTTCTCCCTCTGTC No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088621_913088632 9 Left 913088621 1:115460886-115460908 CCCTACCTAGTTACACCCCTGCA No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088626_913088632 -8 Left 913088626 1:115460903-115460925 CCTGCATTCTTCTCCCTCTGTCA No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data
913088620_913088632 10 Left 913088620 1:115460885-115460907 CCCCTACCTAGTTACACCCCTGC No data
Right 913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913088632 Original CRISPR CTCTGTCACCAGCTTCCTGG GGG Intergenic