ID: 913090623

View in Genome Browser
Species Human (GRCh38)
Location 1:115474389-115474411
Sequence ATACCCACCTTGCCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913090622_913090623 2 Left 913090622 1:115474364-115474386 CCTGAAGGGTGAATGAGGGTGAA No data
Right 913090623 1:115474389-115474411 ATACCCACCTTGCCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913090623 Original CRISPR ATACCCACCTTGCCAAAAAC AGG Intergenic
No off target data available for this crispr