ID: 913091508

View in Genome Browser
Species Human (GRCh38)
Location 1:115479383-115479405
Sequence CAAGCCTGGATGGCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913091508_913091517 26 Left 913091508 1:115479383-115479405 CCCGCAGCTGCCATCCAGGCTTG No data
Right 913091517 1:115479432-115479454 CTCAGGAGCTGCAGCCACATTGG No data
913091508_913091516 9 Left 913091508 1:115479383-115479405 CCCGCAGCTGCCATCCAGGCTTG No data
Right 913091516 1:115479415-115479437 GGATCTGGATAACGTCACTCAGG No data
913091508_913091514 -6 Left 913091508 1:115479383-115479405 CCCGCAGCTGCCATCCAGGCTTG No data
Right 913091514 1:115479400-115479422 GGCTTGGCAATCCATGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913091508 Original CRISPR CAAGCCTGGATGGCAGCTGC GGG (reversed) Intergenic
No off target data available for this crispr