ID: 913092820

View in Genome Browser
Species Human (GRCh38)
Location 1:115491404-115491426
Sequence TGTCCCGCCATTGCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913092814_913092820 -7 Left 913092814 1:115491388-115491410 CCCCATGACTGCCTCCTGTCCCG No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data
913092812_913092820 17 Left 913092812 1:115491364-115491386 CCAGCTGACTCTGCCTGGGCTGC No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data
913092816_913092820 -9 Left 913092816 1:115491390-115491412 CCATGACTGCCTCCTGTCCCGCC No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data
913092811_913092820 18 Left 913092811 1:115491363-115491385 CCCAGCTGACTCTGCCTGGGCTG No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data
913092815_913092820 -8 Left 913092815 1:115491389-115491411 CCCATGACTGCCTCCTGTCCCGC No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data
913092813_913092820 4 Left 913092813 1:115491377-115491399 CCTGGGCTGCTCCCCATGACTGC No data
Right 913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913092820 Original CRISPR TGTCCCGCCATTGCACTGGC TGG Intergenic
No off target data available for this crispr