ID: 913105146

View in Genome Browser
Species Human (GRCh38)
Location 1:115607467-115607489
Sequence CTCTTAACCCACATCTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913105143_913105146 21 Left 913105143 1:115607423-115607445 CCTCCAAAAACTATGCAGATTAA No data
Right 913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG No data
913105144_913105146 18 Left 913105144 1:115607426-115607448 CCAAAAACTATGCAGATTAATGA No data
Right 913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913105146 Original CRISPR CTCTTAACCCACATCTATAT TGG Intergenic
No off target data available for this crispr