ID: 913106144

View in Genome Browser
Species Human (GRCh38)
Location 1:115615872-115615894
Sequence GCTAGCCATTCCTCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913106144_913106158 22 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106158 1:115615917-115615939 TATGGTGGGGGTGGATGGGTGGG No data
913106144_913106151 8 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106151 1:115615903-115615925 GCATCTTTACTGTGTATGGTGGG No data
913106144_913106156 18 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106156 1:115615913-115615935 TGTGTATGGTGGGGGTGGATGGG No data
913106144_913106154 13 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106154 1:115615908-115615930 TTTACTGTGTATGGTGGGGGTGG No data
913106144_913106149 4 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106149 1:115615899-115615921 TGGGGCATCTTTACTGTGTATGG No data
913106144_913106157 21 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106157 1:115615916-115615938 GTATGGTGGGGGTGGATGGGTGG No data
913106144_913106150 7 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106150 1:115615902-115615924 GGCATCTTTACTGTGTATGGTGG No data
913106144_913106152 9 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106152 1:115615904-115615926 CATCTTTACTGTGTATGGTGGGG No data
913106144_913106155 17 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG No data
913106144_913106153 10 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106153 1:115615905-115615927 ATCTTTACTGTGTATGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913106144 Original CRISPR GCTAGCCATTCCTCAAACAC AGG (reversed) Intergenic
No off target data available for this crispr