ID: 913106155

View in Genome Browser
Species Human (GRCh38)
Location 1:115615912-115615934
Sequence CTGTGTATGGTGGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913106144_913106155 17 Left 913106144 1:115615872-115615894 CCTGTGTTTGAGGAATGGCTAGC No data
Right 913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913106155 Original CRISPR CTGTGTATGGTGGGGGTGGA TGG Intergenic
No off target data available for this crispr