ID: 913106468 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:115618156-115618178 |
Sequence | ACAGTGATCCAGGTTTCCCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913106466_913106468 | -7 | Left | 913106466 | 1:115618140-115618162 | CCTACAACACTTGTGCACAGTGA | No data | ||
Right | 913106468 | 1:115618156-115618178 | ACAGTGATCCAGGTTTCCCCTGG | No data | ||||
913106465_913106468 | 8 | Left | 913106465 | 1:115618125-115618147 | CCTAGAACAGGATGTCCTACAAC | No data | ||
Right | 913106468 | 1:115618156-115618178 | ACAGTGATCCAGGTTTCCCCTGG | No data | ||||
913106464_913106468 | 18 | Left | 913106464 | 1:115618115-115618137 | CCTCATTTCTCCTAGAACAGGAT | No data | ||
Right | 913106468 | 1:115618156-115618178 | ACAGTGATCCAGGTTTCCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913106468 | Original CRISPR | ACAGTGATCCAGGTTTCCCC TGG | Intergenic | ||