ID: 913106468

View in Genome Browser
Species Human (GRCh38)
Location 1:115618156-115618178
Sequence ACAGTGATCCAGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913106466_913106468 -7 Left 913106466 1:115618140-115618162 CCTACAACACTTGTGCACAGTGA No data
Right 913106468 1:115618156-115618178 ACAGTGATCCAGGTTTCCCCTGG No data
913106465_913106468 8 Left 913106465 1:115618125-115618147 CCTAGAACAGGATGTCCTACAAC No data
Right 913106468 1:115618156-115618178 ACAGTGATCCAGGTTTCCCCTGG No data
913106464_913106468 18 Left 913106464 1:115618115-115618137 CCTCATTTCTCCTAGAACAGGAT No data
Right 913106468 1:115618156-115618178 ACAGTGATCCAGGTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913106468 Original CRISPR ACAGTGATCCAGGTTTCCCC TGG Intergenic