ID: 913107216

View in Genome Browser
Species Human (GRCh38)
Location 1:115625530-115625552
Sequence GCTTCTCTGCAGGCCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913107216_913107225 9 Left 913107216 1:115625530-115625552 CCTGCCAGGGCCTGCAGAGAAGC No data
Right 913107225 1:115625562-115625584 CACCAGTGACTGGCGCGCCTGGG No data
913107216_913107223 -1 Left 913107216 1:115625530-115625552 CCTGCCAGGGCCTGCAGAGAAGC No data
Right 913107223 1:115625552-115625574 CCTGGCGGGACACCAGTGACTGG No data
913107216_913107227 24 Left 913107216 1:115625530-115625552 CCTGCCAGGGCCTGCAGAGAAGC No data
Right 913107227 1:115625577-115625599 CGCCTGGGAGTCAGTACACTTGG No data
913107216_913107224 8 Left 913107216 1:115625530-115625552 CCTGCCAGGGCCTGCAGAGAAGC No data
Right 913107224 1:115625561-115625583 ACACCAGTGACTGGCGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913107216 Original CRISPR GCTTCTCTGCAGGCCCTGGC AGG (reversed) Intergenic
No off target data available for this crispr