ID: 913109082

View in Genome Browser
Species Human (GRCh38)
Location 1:115641927-115641949
Sequence CTCGGGCTGCGGGGCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913109072_913109082 1 Left 913109072 1:115641903-115641925 CCGCGCCGGGCTCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 189
Right 913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG 0: 1
1: 0
2: 4
3: 51
4: 364
913109075_913109082 -4 Left 913109075 1:115641908-115641930 CCGGGCTCGCAGGGCTGGGCTCG 0: 1
1: 0
2: 0
3: 23
4: 344
Right 913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG 0: 1
1: 0
2: 4
3: 51
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913109082 Original CRISPR CTCGGGCTGCGGGGCGGCGC CGG Intergenic
900092193 1:925339-925361 GGGAGGCTGCGGGGCGGCGCGGG + Intronic
900366838 1:2314965-2314987 CCCGGGCTGGGGGGCGGGACGGG + Intergenic
900396790 1:2456362-2456384 CTTGGGAGGCGGGGCGGCCCTGG + Intronic
900413912 1:2526418-2526440 CGCGGGCTGCGGGGGCGGGCGGG - Intronic
900527395 1:3135904-3135926 CTGGGGCTGCAGAGCGGGGCAGG + Intronic
901007835 1:6180248-6180270 CTCGGGCTGCGGGGCGCGGTGGG - Intergenic
901026430 1:6280923-6280945 CTCGGGCTGCGGGGCTGATCCGG - Intronic
901050717 1:6424700-6424722 CGGAGGCTGCGGGGCGGGGCGGG + Intergenic
901641510 1:10695202-10695224 CGCGGGGTGCGGGGGCGCGCGGG - Intronic
901799858 1:11701727-11701749 CCCGGGCTGCGGGGAGGCGGAGG + Intronic
902375137 1:16026924-16026946 CGGGGGCGGCGGGGCGGGGCGGG + Intronic
902768618 1:18632760-18632782 CTTGGGCAGCGAGACGGCGCCGG + Intronic
903925192 1:26826836-26826858 GGCGGGCAGCGGGGCGGCCCCGG - Exonic
904466999 1:30714204-30714226 CTGGGGCTGGGGAGGGGCGCAGG - Intronic
904591434 1:31617676-31617698 CGCGGGCTGTGGCTCGGCGCGGG - Intronic
904822714 1:33256119-33256141 CTCTGCCTCCGGCGCGGCGCGGG + Intergenic
904942883 1:34177303-34177325 CTCGGGGGGCGGGGCCCCGCAGG - Intronic
905173949 1:36125007-36125029 CTCGGGCTGGGGGGCTCCGAGGG - Intronic
905655487 1:39683920-39683942 ATCGAGGTGCGGGGCCGCGCGGG - Exonic
905670709 1:39788594-39788616 GGCGGGCGGCGGGGCGGGGCGGG + Exonic
906216703 1:44045275-44045297 CTCGTGCTGCGGGACTGCCCTGG + Intergenic
907011764 1:50969432-50969454 CTCGGGCTGCCGGGAGTCCCGGG + Exonic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912554769 1:110508134-110508156 CTCAGGCTCCTGGGCGGGGCTGG + Intergenic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
915302838 1:154961491-154961513 CTCCCGGTGCTGGGCGGCGCAGG + Exonic
915740259 1:158113694-158113716 CTCGGGCTCCGGGCGGCCGCCGG - Intergenic
916548297 1:165827483-165827505 CTCGGGCGGCGGCGGGGCCCGGG + Intronic
916588363 1:166166850-166166872 GTCCGGCTACGGGGCGGGGCCGG - Exonic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
919822171 1:201480531-201480553 CCCCAGCTGCGGGGCGGGGCGGG + Intergenic
919926414 1:202194054-202194076 GCCGGGCTGGGGGGCGCCGCCGG - Exonic
920333388 1:205228156-205228178 GCCGGGCTGCGGGGCGAGGCGGG - Exonic
922488882 1:225999458-225999480 GCCGGGCGGCGGGGCGGTGCGGG + Intergenic
922661169 1:227431738-227431760 CTGGGGCTCCGGGGCCTCGCTGG + Intergenic
922811253 1:228416695-228416717 CGGGGGCTGGGGGGCGGCGGGGG + Intronic
924436748 1:244049083-244049105 CCCGGCCGGCTGGGCGGCGCGGG + Intronic
1063449956 10:6144759-6144781 CTCGGGCTGCTGGGGGAAGCCGG - Intergenic
1063994966 10:11611167-11611189 CGCGGGGTGCGGGGAGGCCCGGG - Intronic
1064208841 10:13347422-13347444 CCCGGGCTGCGGGCCGGCGGCGG + Intronic
1065099922 10:22321943-22321965 CGCGGGCTGCGGGTCGGTCCCGG - Intronic
1065214902 10:23439582-23439604 CTCGGGCTCGGGCGCGGCGCCGG - Exonic
1067286475 10:44911203-44911225 CTCAGGCGGCTGGGCTGCGCTGG + Exonic
1067853244 10:49768760-49768782 CTGGGGCGGCGGGGAGGGGCTGG + Intergenic
1070257599 10:74825420-74825442 GGCGGGCTGGCGGGCGGCGCGGG + Intergenic
1071618082 10:87094638-87094660 CCCCGGCTGCGGGGCGGCGGCGG + Exonic
1072620313 10:97075126-97075148 CTCGGGCTGCAGGGGGCCGAGGG - Intronic
1072982996 10:100115301-100115323 CGGGGGGTGCGGGGCGGCCCCGG - Intergenic
1073288103 10:102400389-102400411 CTGGCGCTGCGGGCAGGCGCTGG + Exonic
1073325907 10:102643974-102643996 CGCGGGCTGCGGGGCGCGGGCGG - Intergenic
1073392845 10:103193324-103193346 CGCGAGCAGAGGGGCGGCGCGGG - Intergenic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1076402107 10:130191022-130191044 CTCGAGCCGCAGGGCGTCGCAGG + Intergenic
1076792915 10:132786241-132786263 CGCGGGCGGGGGGGGGGCGCCGG - Intergenic
1076818206 10:132924926-132924948 CTCGAGCTGCGGGGCTGGGGCGG + Intronic
1076883558 10:133251386-133251408 CTCGGGCTGCCGGGTGGAACTGG + Intergenic
1076895460 10:133309186-133309208 CTACGACTGCGGGGCGGGGCCGG + Intronic
1077008314 11:369373-369395 CGCGGGGTGCGGGGCGGAGGAGG - Intergenic
1077021007 11:417158-417180 CTCGGGCTTCCGGGCGACGCGGG + Intronic
1077227132 11:1443297-1443319 CCCGGGCTGTTGGGGGGCGCAGG - Intronic
1077360820 11:2139510-2139532 CTCGGGTTGCGGGGGCGGGCCGG - Intronic
1077406398 11:2384326-2384348 CTCGGGAAGCGGGGCGTCTCGGG + Intronic
1078003110 11:7513616-7513638 CTCCGGTTGCGGGGAGGCCCGGG - Intronic
1078091830 11:8268710-8268732 CTCCGGCTGCGGCCCGGCCCGGG - Intronic
1078375900 11:10792725-10792747 GCAGGGCTGCGGGGCGGGGCAGG + Intergenic
1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG + Intronic
1081115314 11:39192703-39192725 CTCGGGCTGAGGGGAGGCTCAGG + Intergenic
1081575868 11:44318260-44318282 CTTGGGGTGGGGGGCGGGGCAGG - Intergenic
1081637041 11:44727779-44727801 CCCTGGCAGCGGGGCGGGGCGGG + Intronic
1083432551 11:62621847-62621869 CTCGGTGAGCGGGGCGGGGCGGG - Exonic
1083442726 11:62687809-62687831 CTCGGGCGGCGGCTCGGCGCGGG + Exonic
1083442843 11:62688257-62688279 GTCGGGCGGCTGGGCGGGGCTGG + Exonic
1083609676 11:63998924-63998946 GGCGGGCCGTGGGGCGGCGCGGG + Intronic
1083616248 11:64028087-64028109 CTCAGGATGCGGGGCTGGGCAGG + Intronic
1083698643 11:64459194-64459216 GTGGGGGTGCGGGGCGGGGCGGG - Intergenic
1083728884 11:64642749-64642771 CCAGGGCCGGGGGGCGGCGCGGG + Intronic
1084184548 11:67464752-67464774 CGGGGGCTGTGGGGCGGCACTGG - Intronic
1085561097 11:77473669-77473691 CACGGGCAGCGCGGCGGCGGCGG - Exonic
1086395706 11:86413117-86413139 GTCGGGCTGCTGTGCGGCCCGGG + Intronic
1088172963 11:107018270-107018292 CCCGGGCTCGGCGGCGGCGCCGG + Exonic
1088314924 11:108498100-108498122 CCCGGGCGGCGGGGACGCGCGGG + Intronic
1088604086 11:111512425-111512447 CGCGGGCCGAGGGGCGGGGCGGG - Intergenic
1088850442 11:113699615-113699637 CTGGGGCTGCTGGCCGGTGCAGG - Exonic
1089346989 11:117797001-117797023 CGCGGGCGGCTGGGCGGCGGAGG - Intronic
1089533793 11:119148983-119149005 CGCGGGCTGCCGGGCGGCGCGGG + Intergenic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1090817781 11:130314433-130314455 CTGGGGCGGCGAGGCGGCGGCGG + Exonic
1091973727 12:4809409-4809431 CTCGGGCGCCGGGGCAGCCCCGG + Exonic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095949354 12:47773445-47773467 CCCGGGACGCTGGGCGGCGCGGG + Intronic
1095958306 12:47819067-47819089 CGCGGGAAGCGGGGCGCCGCAGG - Intronic
1097787826 12:63780173-63780195 CTGGGGCTGCTGGGCGGCTGGGG + Intronic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1101993846 12:109510497-109510519 CTCGGGCAGCGTGCCGGAGCAGG - Intronic
1102084389 12:110124272-110124294 CACGAGCTGGGGGGCGGGGCCGG - Intergenic
1102183852 12:110932894-110932916 CTCGGGCTGCCGGGTGGCAAAGG - Intergenic
1102571658 12:113830561-113830583 CTAGGGCTGCGGGGCGGGGGGGG + Intronic
1103363934 12:120369108-120369130 CGCGGGCAGCGGAGCGGCGGCGG + Exonic
1103623897 12:122204569-122204591 CTCAGGATGCCGGGCGGCGGCGG - Exonic
1103923541 12:124411727-124411749 CACGGACTGTGGGGCGGTGCGGG - Intronic
1104448767 12:128853361-128853383 CCCTGGGTGCGGGGTGGCGCGGG - Intergenic
1104466327 12:128993837-128993859 CTCAGGCTGGGGAGTGGCGCAGG - Intergenic
1104857323 12:131908271-131908293 CTGGGGCTGCGGGTCGGGTCGGG + Intronic
1104968838 12:132522087-132522109 CCCAGGCTGAGGGGCCGCGCCGG - Intronic
1105031498 12:132887438-132887460 GCCGGGCTGCGGGGCTGCGTGGG - Intronic
1106157416 13:27171529-27171551 CTCGGGCGGGCGGGCGGCGCTGG - Intronic
1106571575 13:30932794-30932816 GCCGGTCTGCGGGGCGGGGCTGG + Intronic
1113379012 13:109786330-109786352 CTCGGGCTCTCGGGCGGCGCCGG + Exonic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1113542012 13:111115902-111115924 GTCGGGGGGAGGGGCGGCGCGGG + Intronic
1114150347 14:20031771-20031793 CTCGGGGTGGGGGGAGGCGGGGG - Intergenic
1114211916 14:20623011-20623033 CTAGAGTTGCGGGGGGGCGCGGG + Intergenic
1115399178 14:32938909-32938931 CTCGGGAGCCGGGGCGGCCCGGG + Intronic
1115761665 14:36582656-36582678 GGCGGGGTGCGGGGCGGGGCGGG - Intergenic
1116012823 14:39370625-39370647 CTCGGGCAGCAGAGAGGCGCTGG - Intronic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1116187000 14:41609794-41609816 CTGGGGCTGCTGGGGGGCGGGGG + Intronic
1117368274 14:55052084-55052106 GTCTGGCTGCGGGGCGGGGCGGG + Intronic
1118265795 14:64294175-64294197 CTGGGGCTGCGGGGCAGGGCTGG - Exonic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119410312 14:74426158-74426180 CGAGGGCTGCGCGGCGGCGGCGG - Intergenic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1122130880 14:99604115-99604137 CGCGGGCTCCCGGGCGGCCCCGG - Intergenic
1122162201 14:99793067-99793089 CAGGGGCTGCGGGGCGCGGCGGG - Intronic
1122418494 14:101561336-101561358 CTTGGGCTGAGGGCGGGCGCAGG - Exonic
1122542786 14:102507315-102507337 CCCGGTCTGCGGGACGGCGGCGG - Exonic
1122657675 14:103273337-103273359 ATCGGGCGGGGGCGCGGCGCGGG - Intergenic
1122688907 14:103522500-103522522 GGCGGGCTGCGGGGAGACGCGGG + Exonic
1122750325 14:103928302-103928324 CTAGCGCGGCGGGGCGGGGCCGG + Intergenic
1123007006 14:105328625-105328647 CTCGGGCTGCTGGGAGGGCCTGG - Intronic
1123051582 14:105546718-105546740 GCCGGGCTGCGGGGCGCAGCGGG + Intergenic
1123076994 14:105672421-105672443 GCCGGGCTGCGGGGCGCAGCGGG + Intergenic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1123684488 15:22787174-22787196 CGAGGGCTGCCGGGCGGCGCGGG - Intronic
1124006953 15:25802216-25802238 CTCGGTCTGTGCTGCGGCGCAGG - Intronic
1125051196 15:35299554-35299576 CGCGGGGCGCTGGGCGGCGCGGG + Intronic
1128119191 15:65133420-65133442 CGCGGGCTCCAGGGCGGCCCCGG + Exonic
1128423959 15:67521143-67521165 CTCGGGCACCCGCGCGGCGCCGG + Exonic
1128454120 15:67823209-67823231 CTTGGGCTGCGGGGAGGCGGCGG + Intronic
1129189225 15:73927718-73927740 CTCGGGCGGCGGGTTGGCGTAGG - Exonic
1129219406 15:74122810-74122832 CTGGGGTTGGGGGGCTGCGCAGG - Intronic
1129460988 15:75700014-75700036 CTAGGGCTGGGGGGCTGTGCAGG - Intronic
1129844872 15:78763672-78763694 GCCGGGCTGCGGGGAGGAGCAGG - Intronic
1129863132 15:78879222-78879244 CTTGGGGGGCGGGGCGGGGCGGG - Intronic
1132238446 15:100239343-100239365 CACGGGATGAGGAGCGGCGCTGG + Intronic
1132563662 16:610660-610682 CCCGCGCTGGGGGACGGCGCAGG - Intronic
1132672973 16:1109287-1109309 CGGGGGCTGGGGGGCGGTGCAGG + Intergenic
1132838001 16:1964404-1964426 GTCGGGCCCCTGGGCGGCGCCGG - Intronic
1132877985 16:2148719-2148741 CGCGGGGTGCGGGACGGCCCAGG + Exonic
1132904762 16:2276920-2276942 CTGGGGCTCTGGGGTGGCGCTGG - Intronic
1132942323 16:2514338-2514360 CGAGGGCTGCGGGGAGCCGCCGG + Intronic
1132947058 16:2537745-2537767 CAGGGCCTGCGGGGCGGGGCTGG - Intergenic
1132968541 16:2673417-2673439 CGCGGGGGGCGGGGCGTCGCGGG - Intergenic
1132987874 16:2777358-2777380 CGGCGGCTGCGGGGCGGCACGGG - Intergenic
1133035361 16:3031102-3031124 CTCGGGCTGCCAGGCCTCGCCGG + Exonic
1133188519 16:4116575-4116597 CTGGGGCTGCGGGGCGGGGCGGG + Intergenic
1133207191 16:4240736-4240758 CTGGGGCTGGGGGGCAGCACAGG + Intronic
1133332941 16:4987717-4987739 CTGGGGCTGGGGGGCGGAGGAGG + Intronic
1134134048 16:11668341-11668363 CTGGGACGGCGGGGCGGGGCGGG - Intergenic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1136293293 16:29288524-29288546 CTAGGGCTCCGGGGCAGCTCTGG + Intergenic
1137708074 16:50548838-50548860 CTGGGGCTTCGGGGTGGCCCTGG - Intronic
1138514636 16:57529213-57529235 GTCGGGCTCAGGGGCGGCTCCGG + Exonic
1138562232 16:57808323-57808345 CTCGGGCTGAGAGGCGGGCCGGG - Intronic
1138651425 16:58463594-58463616 CTCGGCCCGCGGGGCGGTGCCGG - Intronic
1139390798 16:66605358-66605380 CTCGACCTGCGGGGCCGAGCCGG + Intronic
1139549589 16:67666260-67666282 CTTGAGCTGTGGGGCGGAGCCGG + Exonic
1141553202 16:84819854-84819876 CTGAGCCTGCGGGGCGGGGCCGG + Intergenic
1141665435 16:85463060-85463082 CGCGGCCCGGGGGGCGGCGCAGG + Intergenic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1142156445 16:88534675-88534697 CCCGGGCTGCGGGGAGGCGGCGG - Exonic
1142169195 16:88611653-88611675 CTCGGGCTGTGGGCCTGCACTGG - Intronic
1142300963 16:89257542-89257564 CGCGGGCTGCTCGGCGGCCCCGG + Intergenic
1142321444 16:89385804-89385826 CTCTGGCTGCGCAGCGGCGGGGG - Intronic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142395177 16:89828118-89828140 CTGGGTCTGCGGGGGAGCGCCGG + Intronic
1142763606 17:2054529-2054551 CTAGGGCTGCGGGAAGGGGCGGG + Intronic
1142836813 17:2593662-2593684 CTGGAGCGGCGGGGCGGCGGCGG + Intronic
1143512847 17:7405501-7405523 CTGGGCCTGCGGGGCCGCGGGGG + Intronic
1143587165 17:7856032-7856054 CTGGGGCTGGGGGGCGGGGCTGG + Exonic
1143750222 17:9022054-9022076 CTCGGGCGGCGTGGGGGCGGCGG + Intronic
1144854136 17:18258698-18258720 CTCTCGCTGCCGGGCCGCGCCGG + Exonic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1145243586 17:21253271-21253293 GCGGGGCTGCGGCGCGGCGCCGG + Exonic
1145247001 17:21275893-21275915 CCCGGGCTGGGGGGCGTGGCTGG + Intergenic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1147757890 17:42780540-42780562 GGCGGGCCGCGGGGCGGCGACGG + Intergenic
1148178404 17:45586316-45586338 CGCGGGCTGCAGCGCGGTGCGGG - Intergenic
1148698612 17:49575587-49575609 CCCGGGCTGCGGGCCGGCAGGGG + Intergenic
1148760499 17:49997275-49997297 CACAGTCTGCGGGGCGGGGCAGG - Intergenic
1148830176 17:50426116-50426138 CTCCGCCGGCGGGGCGGGGCGGG - Intergenic
1148858156 17:50590454-50590476 CTCGGGCTGCAGGGCAGGGTGGG - Exonic
1152197382 17:78925506-78925528 CGCGGGCTGGGGGGAGGCGCGGG - Intergenic
1152361276 17:79834259-79834281 CTCGGGCTGCGGGAGGGCGGCGG + Exonic
1152924174 17:83079924-83079946 GCCGGGCTGCTGGGCGGCGCGGG + Exonic
1153382637 18:4455489-4455511 CCCAGGCCGCGGGGAGGCGCCGG + Intergenic
1153451778 18:5238110-5238132 CAAGGCCTGCGGGGAGGCGCAGG + Intergenic
1153480621 18:5543478-5543500 CTCGGGCTGGGGGCGAGCGCGGG - Intronic
1154326080 18:13391296-13391318 CTCGGGCTGTGGGGGAGGGCTGG + Intronic
1155130844 18:22933339-22933361 CGCGGGCTCCCGGGCGGGGCGGG + Intronic
1157594699 18:48857493-48857515 CTGGGGCTGCAGGTCGGCGGGGG + Intronic
1159012925 18:63075272-63075294 CTCGGGCCGCGGGAGGGAGCTGG - Intergenic
1159040541 18:63319920-63319942 CTGGTCCTGCGCGGCGGCGCTGG + Exonic
1159947707 18:74456772-74456794 CTCGGGCTCAGGGGTGGCGAGGG + Intronic
1160163455 18:76491910-76491932 CTCGGGCTGGGGGGCGGAAATGG + Intronic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160719286 19:590320-590342 CTCGTGCCGCGGGGCGGCCTCGG + Exonic
1160788776 19:913252-913274 CTGGGGCTGCGCGGCGGGGCGGG + Intergenic
1160823340 19:1068157-1068179 CGGGGCCTGCGGGGAGGCGCGGG - Intronic
1160838950 19:1137511-1137533 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160838974 19:1137565-1137587 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160838986 19:1137592-1137614 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839030 19:1137700-1137722 CTCAGGCTGGGGGGAGGCTCGGG + Intronic
1160839038 19:1137717-1137739 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839050 19:1137744-1137766 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839062 19:1137771-1137793 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839084 19:1137825-1137847 CTCAGGCTGGGGGGAGGCTCGGG + Intronic
1160839092 19:1137842-1137864 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839116 19:1137896-1137918 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839128 19:1137923-1137945 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839161 19:1138004-1138026 CTCAGGCTGGGGGGAGGCTCGGG + Intronic
1160839169 19:1138021-1138043 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839181 19:1138048-1138070 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839193 19:1138075-1138097 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839205 19:1138102-1138124 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839227 19:1138156-1138178 CTCAGGCTGGGGGGAGGCTCGGG + Intronic
1160839235 19:1138173-1138195 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160858978 19:1229708-1229730 CGCGGGCTGCGGGGCCGGGCGGG + Exonic
1160919539 19:1513249-1513271 CTCGGGCGGGGGCGCGGCGCGGG + Intronic
1160930503 19:1567761-1567783 CGCGGACGGCGGGGCGGCTCCGG - Exonic
1160930688 19:1568258-1568280 CTCTGGCTGCGGCTCGGCGGCGG + Intergenic
1161241102 19:3224530-3224552 CCGGGGATGCGGGGAGGCGCCGG + Intergenic
1161320168 19:3637468-3637490 CTCGGGCAGCAGGGAGCCGCAGG - Intronic
1161401365 19:4067284-4067306 GGCGGGGTGCGGGGGGGCGCGGG + Intergenic
1161513153 19:4682921-4682943 CACGGGCTCCAGGGCGGCCCCGG - Intronic
1162007549 19:7789682-7789704 GCCGGGCGGTGGGGCGGCGCCGG + Intergenic
1162236016 19:9310056-9310078 CTCGGCCTGAGGGGCGGAACTGG + Intergenic
1162572119 19:11479952-11479974 CTCGGGCTGCGGGGAGGGGGAGG - Intronic
1163442440 19:17328725-17328747 CGGGGGCTGCGGGGCGCCGGAGG - Exonic
1163592828 19:18203978-18204000 GTGGGGCTGCGCGGCGGCGGCGG + Exonic
1164639314 19:29812515-29812537 TGAGGCCTGCGGGGCGGCGCGGG - Exonic
1164835059 19:31350688-31350710 CGTGGGCGGCGGGGCGACGCGGG + Intergenic
1165058904 19:33195277-33195299 CTCGGGGTGCGGGGCAGGGCTGG + Intronic
1165255921 19:34577220-34577242 CAAGGGCTGTGGGGTGGCGCTGG + Intergenic
1165871413 19:38975804-38975826 CTCCGGCTGCGGGGCCCAGCGGG + Exonic
1166366406 19:42280627-42280649 CGCGGGCCGCGGCGGGGCGCCGG - Intronic
1168336208 19:55599214-55599236 CTCAGGCTGCGGGGTGGAGGAGG - Intronic
927713879 2:25341066-25341088 CTGGGGGTGCGGGGCGCCGGCGG - Intronic
928411527 2:31058034-31058056 CTAGGGCTGAGGGGCAGGGCAGG - Intronic
930089416 2:47520951-47520973 CTCGGGCGGCGTGGGCGCGCTGG - Exonic
930411209 2:51028192-51028214 CCTGGGCTGCTGGGCGGAGCTGG - Exonic
932152692 2:69387347-69387369 CTCGGGGGGCGGGGCAGCGCTGG - Intergenic
932780084 2:74554230-74554252 GCCGGGCGGCGGGGCGGCCCCGG + Exonic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936556872 2:113503788-113503810 CCGGCTCTGCGGGGCGGCGCGGG - Intergenic
936985804 2:118310579-118310601 CTTGGGTTTCGGGGCAGCGCGGG + Intergenic
937091938 2:119212318-119212340 GCTGGGCTGTGGGGCGGCGCTGG - Intergenic
937853735 2:126657727-126657749 CTTGGGCTGCTGGGCTGGGCTGG - Intronic
937908430 2:127064013-127064035 CTCGGCCTGGGGGGCAGCACGGG + Exonic
937956256 2:127423194-127423216 GGCGGGCGGCGGGGCGGGGCTGG + Intronic
941772767 2:169362199-169362221 CTAGGGCCGGGCGGCGGCGCGGG - Intronic
941808635 2:169734185-169734207 CGCGGGCAGCGAGGCCGCGCGGG + Intronic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
942452613 2:176117654-176117676 GTCGGGCTCCGGCTCGGCGCTGG - Intronic
947399123 2:229714588-229714610 CGGGGCCTGCGGGGCGGGGCGGG + Intergenic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948463487 2:238141383-238141405 CTCGGGCAGGTGGGCGGCCCGGG - Exonic
948491671 2:238317085-238317107 CTCTGTCTGCGGGGTGGCGGGGG + Intergenic
1168943916 20:1735855-1735877 GGCGGTCTGCGGGGCGGCCCTGG + Intergenic
1169269322 20:4187253-4187275 CATGGGCTGCGGGGCGGGGATGG - Exonic
1169673789 20:8132468-8132490 CTCTGCCTGCTGAGCGGCGCCGG + Intronic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1171175463 20:23048677-23048699 GTCTGCCTGCAGGGCGGCGCCGG + Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1173279838 20:41618250-41618272 CCCGGCCGGCGGGGCGGGGCCGG + Intronic
1173322257 20:41998695-41998717 CCAGGGCTGCGGCGCCGCGCAGG - Intergenic
1174169098 20:48605149-48605171 CACGGGCTGACGGGCAGCGCTGG + Intergenic
1175231034 20:57473430-57473452 CTCTGCCTGCGGGGGGACGCTGG + Intergenic
1175399553 20:58692785-58692807 CGCGGGCTGCCGGGCAGGGCCGG + Exonic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175771896 20:61629255-61629277 CTCCGGCTGGGGGGCTGGGCTGG - Intronic
1175856123 20:62122046-62122068 CCCAGGGTCCGGGGCGGCGCCGG + Intergenic
1175997105 20:62816888-62816910 GGCGGGCTGGGCGGCGGCGCGGG + Intronic
1176129071 20:63488603-63488625 CACGGTCTGCGGGGCGGCCACGG + Intronic
1176131603 20:63498875-63498897 CCCGGGGTGGGGGGCGGCGCGGG - Intronic
1176214472 20:63941712-63941734 CTTGGGCAGCGGGGCGGGACGGG - Intronic
1179522465 21:41954015-41954037 CTCTGGCCGCGGGGCGGGGCGGG + Intergenic
1179783914 21:43719215-43719237 CTCGGGCTCCGGCTCGGCTCGGG - Exonic
1179810251 21:43865392-43865414 CTCGGGCGGCGGCGGGGCGTGGG - Intronic
1180236043 21:46459566-46459588 CCCGGGGTGAGGGGCCGCGCGGG - Intronic
1180960708 22:19761109-19761131 CTCGGGCTCGGCGGCGGCGCTGG - Exonic
1180999143 22:19979882-19979904 CGCGGGCTGAGGTGCGGCGCCGG - Exonic
1181155502 22:20917621-20917643 CTCGGGCTGCTCGGCGTCCCAGG - Exonic
1181934477 22:26429188-26429210 CGGGGCCTGCGGGGCGGGGCCGG - Intergenic
1182429058 22:30289544-30289566 CACGGGAGGCGGGGCGGCGGGGG + Exonic
1182903849 22:33920440-33920462 CCCGGGCTCCGGCGCGGCGGCGG + Intronic
1182903980 22:33920831-33920853 CGCGGGCAGCCGGGCGCCGCTGG + Intronic
1183546038 22:38455305-38455327 CGCGGGCGGCGGGGCGCCCCGGG - Intergenic
1183663278 22:39233828-39233850 CTCGGCCTCCAGGGCGGGGCCGG + Intronic
1183821136 22:40346721-40346743 CCCGGGCTGAGGGGCTGGGCCGG + Intronic
1183824002 22:40370746-40370768 CGGGGGCTGCGGGGCGGCTGTGG + Intronic
1184229564 22:43151459-43151481 CCCGGGCTGCCAGGCGGGGCGGG + Intergenic
1184412216 22:44331843-44331865 GGCGGGCGGCCGGGCGGCGCGGG - Intergenic
1184523877 22:45010103-45010125 CTCGGGGTGCCGGGCCGCGGCGG - Intergenic
1184568844 22:45309798-45309820 ATCTGGCGGCGGGGCGGGGCGGG + Intronic
1184659819 22:45960577-45960599 CCCTGGCTGCCGGGCGGCCCTGG + Intronic
1184840871 22:47051707-47051729 CTGGGGCTGCAGGGAGGTGCCGG - Intronic
1185055371 22:48576159-48576181 CGCTGGCTGCGGGGCGCCGGGGG - Intronic
1185296697 22:50058274-50058296 CTCGGGCTGTGCAGCGGCGGCGG + Intergenic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
1185397561 22:50600672-50600694 CCCGGACTCCGCGGCGGCGCGGG - Exonic
949516758 3:4814506-4814528 CACGGGCTGCGGAGCGGGGGTGG + Exonic
950193353 3:10992842-10992864 CTCGGGACGCGGGGCCGCTCGGG - Exonic
950215268 3:11154438-11154460 CTCGGGGAGCGGGGCGCCGGAGG - Intronic
950487781 3:13283018-13283040 AGCGGGCGGCGGGGCGGCGGCGG + Intergenic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
952942297 3:38454077-38454099 CCCGGGCTCCGGGGCGACGCGGG - Exonic
953980210 3:47409847-47409869 CTGGGGCTGTGGTGCGGCTCGGG + Intronic
960977955 3:123194769-123194791 CTGGGGCGGCGGGGCGGGGCGGG - Intronic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
961663728 3:128483942-128483964 CTCTGGCGGCGGGACGGCACCGG - Exonic
962714484 3:138115108-138115130 GCCGGGCTGCAGGGCCGCGCCGG + Intronic
968178199 3:196569065-196569087 CTCGGGCTCTGGGGCCGCGGGGG + Exonic
968434063 4:576071-576093 CGCGGGGTGCGGGCCGGCTCGGG - Intergenic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968573371 4:1353938-1353960 CTGGGGCTGGGGGGCGGGGGCGG - Intronic
968651990 4:1763816-1763838 CTCTGGCCGCGGGGCCGGGCCGG + Intergenic
969075601 4:4575434-4575456 CGCGGGCCGCCTGGCGGCGCTGG + Intergenic
970456214 4:16226532-16226554 CTCGGGCTCCGGCGAGGGGCGGG - Exonic
971018950 4:22515690-22515712 CTCGCGCTGCTGGGAGGCGGCGG - Exonic
974019029 4:56676756-56676778 CTCTGGCTGCAGGGCTGCTCTGG + Intronic
977370301 4:96126394-96126416 CTCGGGTTCCGGGTGGGCGCAGG - Intergenic
978366632 4:107989819-107989841 CGCGGGCTGCAGGGCCGCGTAGG + Exonic
981244732 4:142522333-142522355 CTCGGGGTGGGGGGCGGGGGCGG - Intronic
981516849 4:145619284-145619306 CTGGGGCTGGGTGGCGGTGCGGG - Exonic
981688514 4:147481252-147481274 CCCGGGCTCCGGCGCGGCGGCGG - Exonic
983077555 4:163344078-163344100 CGCGGGCTGCGAGTCTGCGCAGG + Intronic
985794503 5:1952248-1952270 CCCTGGCTGAGGGGCGGGGCTGG + Intergenic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
990041517 5:51383159-51383181 CTCGGGCTGCCGGGCTGTTCTGG - Intergenic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
995206625 5:109487935-109487957 CTACGGCTGCGGGGAGGCTCCGG + Intergenic
995725471 5:115177616-115177638 CTGGGGCTGCGGGGCGGGGCAGG + Intronic
998113305 5:139518275-139518297 CTCGGGCTCCTGGGAGGAGCGGG - Intergenic
998583222 5:143402739-143402761 CCCGGGCTCCGGGGAGGCCCCGG - Intronic
1002021441 5:176366363-176366385 CTCGGGCTGCGGGGAAGCGGAGG - Exonic
1002170314 5:177371039-177371061 TCCGGGCCGCGGGGCGGGGCGGG + Intronic
1002523970 5:179805813-179805835 ACCGGCCAGCGGGGCGGCGCGGG + Intronic
1002638333 5:180618991-180619013 GGCGGCCTGCGGGGCGCCGCGGG - Intronic
1002691464 5:181053324-181053346 CGCGGGCGGCGGGGCGGGGAGGG + Intronic
1002944019 6:1743652-1743674 CACGGGGAGCGGGGCTGCGCTGG - Intronic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1006860849 6:37170682-37170704 CCGGGGATGCGGGGCGGCGGCGG + Intronic
1006932543 6:37696833-37696855 CTCGGGCTGCGCCGCCTCGCGGG - Exonic
1007421664 6:41723525-41723547 CTGGGGCTGGGGTGCGGCCCTGG - Intronic
1012930654 6:105312861-105312883 CCGGGGCTACGGGGCGGCACTGG + Intronic
1017738132 6:157381660-157381682 CGGGGGCTGCGGGGCCGAGCGGG + Exonic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018385458 6:163299416-163299438 CTCTGGCTGCAGGGCAGGGCGGG - Intronic
1019303697 7:322391-322413 CTGGGTCTGCGGGGCGGCGGGGG - Intergenic
1019498629 7:1353062-1353084 CTCGGCCTGGGTGGCGGCGGCGG + Intergenic
1026523058 7:71132741-71132763 CTCGGGCTCCGGCGAGGCGCGGG - Exonic
1026794122 7:73354868-73354890 CTGGGGCTGCGAGGCAGGGCTGG + Intronic
1027250097 7:76393564-76393586 AGCGGGCTGCGGGCCTGCGCTGG - Exonic
1028373428 7:90119626-90119648 CTCCGGCTCCGGGGCGGAGGCGG - Intergenic
1029457217 7:100677425-100677447 CGCGGGCTGCGGGGTGGGGCAGG + Intronic
1031361823 7:120857362-120857384 CTGGGGCGGCGGGGCGGGGGCGG + Intronic
1033222875 7:139540274-139540296 CTCGGGCTGGGGGGGCGGGCAGG + Intronic
1034500460 7:151447475-151447497 GTGGGGCTGGGGGGAGGCGCGGG - Intergenic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1035169774 7:157010829-157010851 CCCGGGCTGTTGCGCGGCGCTGG + Intergenic
1035627257 8:1080270-1080292 CGCGGGCGGCGGGGCGGGGGTGG - Intergenic
1038883503 8:31639658-31639680 CTCGGGCGCGGCGGCGGCGCGGG + Intronic
1039050213 8:33485533-33485555 CTTGGGGTGGGGGGCGGCCCGGG + Intronic
1039979133 8:42391836-42391858 CTGGGGGTGCGAGGCTGCGCAGG + Intronic
1041781227 8:61579704-61579726 CTCAGGCTCTGGGGCAGCGCAGG - Intronic
1042040045 8:64580765-64580787 CCCGGGCTGCGCGCCGGCGCGGG + Exonic
1042551025 8:69994335-69994357 CTCGGGTTGGGGGGGGGGGCGGG - Intergenic
1043388185 8:79768092-79768114 CGCGGGCGGCGGGGAGGCGCGGG + Intergenic
1043428404 8:80171350-80171372 CTCGGGCTTTGGCTCGGCGCGGG - Intronic
1044250683 8:90001455-90001477 CTCGGGCCGGAAGGCGGCGCAGG - Exonic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1049166383 8:141128576-141128598 CGCCGTCTGCGGGGCGGGGCTGG - Intronic
1049237277 8:141518617-141518639 CTCGGGCTCCGGGAAGGCGGCGG - Exonic
1049419610 8:142510940-142510962 CCCGAGCTGCGGGGGGGCGGAGG - Exonic
1049621060 8:143598535-143598557 GTCGGGCAGGGGGCCGGCGCCGG - Exonic
1049659979 8:143815552-143815574 CTCGGACTGCGGGCCTGGGCAGG + Intergenic
1049684512 8:143933928-143933950 TTAGGGCTGCAGGGCGGGGCAGG + Intronic
1049812303 8:144580929-144580951 CTCGGGCTCCAGGGAGGAGCTGG + Exonic
1049850184 8:144826701-144826723 CTCCGGCTGCTGGGCTTCGCCGG + Intergenic
1049989404 9:977309-977331 CGGCGGCTGCGGGGCGGCGACGG - Exonic
1051206377 9:14693318-14693340 CCCGGCCTGGGCGGCGGCGCCGG - Exonic
1053198355 9:36136699-36136721 CCTGGGCTCTGGGGCGGCGCTGG + Intronic
1055757622 9:79572671-79572693 CTCGGTCTGAGGGGCGGCTCGGG - Exonic
1057312955 9:93953073-93953095 CCCGGGCTGCCCGGCGCCGCGGG - Exonic
1057479639 9:95434426-95434448 CTCCGGCTGCGGGAGTGCGCTGG + Intergenic
1058753315 9:108060561-108060583 CTCGGGGGGCGGGGTGGCGGGGG + Intergenic
1059119765 9:111631442-111631464 CCGGGGCTGCCGGCCGGCGCTGG + Exonic
1059208454 9:112487389-112487411 GCCGGGCGGCGGGGCGGCCCGGG - Intronic
1060087463 9:120714906-120714928 CCCGAGCTGGGGTGCGGCGCTGG - Intergenic
1060263169 9:122093190-122093212 CTGGGGCGGCGGAGCGGCGGCGG - Exonic
1061075740 9:128340534-128340556 CTGGGGCTGCGCTGCGCCGCCGG + Intergenic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061208698 9:129178476-129178498 CTGGGGCTGCCGCGCCGCGCGGG + Intergenic
1061211970 9:129198885-129198907 CTCGGGCTGCGCGGCAAGGCTGG + Intergenic
1061453424 9:130681227-130681249 CTCTGGCCGCGGGGCGGGGCGGG - Exonic
1061802791 9:133121268-133121290 GTCAGGCTGGGGGGCGGGGCCGG + Intronic
1062165329 9:135104755-135104777 CTCCGGCTGCTGGGGGGCCCTGG - Intronic
1062349734 9:136133019-136133041 CTGGGCCTTCGGGGCGGCACTGG - Intergenic
1062405178 9:136392813-136392835 CGAGGGCTGCGGGGCGGGGCAGG + Intronic
1062488153 9:136791337-136791359 CTCGGGGAGCGGGCCTGCGCAGG - Exonic
1062656183 9:137605520-137605542 CGCGGGCTACGGGGCGGCCGGGG + Intergenic
1189160370 X:38804057-38804079 CCCGGGCTGAGGGAGGGCGCCGG - Exonic
1190302269 X:49063926-49063948 CGCGGGCTGTGGGGGGCCGCCGG - Exonic
1196965223 X:121047794-121047816 CCCCGGCTGCGAGGCGGCGGCGG - Exonic
1197754448 X:129984131-129984153 GGCGGGCGGCGGGGCGGGGCCGG + Intronic
1198047017 X:132913310-132913332 CTGGGGCTGCGGGCTGGAGCAGG + Intronic
1199264899 X:145818251-145818273 CTCGCGCAGCGGGGTGGCACAGG + Exonic