ID: 913110812

View in Genome Browser
Species Human (GRCh38)
Location 1:115655512-115655534
Sequence TCATACAGGCAGATGTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913110807_913110812 18 Left 913110807 1:115655471-115655493 CCTGCCCCTCACACAACACGCAC No data
Right 913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 84
913110810_913110812 12 Left 913110810 1:115655477-115655499 CCTCACACAACACGCACAGATAT No data
Right 913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 84
913110809_913110812 13 Left 913110809 1:115655476-115655498 CCCTCACACAACACGCACAGATA 0: 1
1: 0
2: 0
3: 13
4: 226
Right 913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 84
913110808_913110812 14 Left 913110808 1:115655475-115655497 CCCCTCACACAACACGCACAGAT 0: 1
1: 0
2: 2
3: 29
4: 316
Right 913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 84
913110806_913110812 30 Left 913110806 1:115655459-115655481 CCACTTGCTCTTCCTGCCCCTCA No data
Right 913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913110812 Original CRISPR TCATACAGGCAGATGTTGCG TGG Intronic
902123842 1:14191821-14191843 TCACACAGGCAGGTGATGGGTGG + Intergenic
905600155 1:39242881-39242903 TCATAGAGACAGGGGTTGCGGGG - Intronic
907011397 1:50967179-50967201 TCATACAGCCAGAGGGTGTGAGG - Intronic
907935749 1:59040782-59040804 TCATACAGGAAGGTTTTGAGTGG + Intergenic
909406576 1:75296928-75296950 TCATACAGTCAGGTGTTGACTGG + Intronic
913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG + Intronic
914453543 1:147814694-147814716 TCCTACAGTCACATGTTGGGGGG - Intergenic
917197046 1:172477846-172477868 TCAGACAGGCAGGTCTTGCTGGG - Intergenic
919583542 1:199407481-199407503 TGATTCAGGCTGATGTTGCTTGG + Intergenic
922182769 1:223248359-223248381 TCCTGCAGGCAGAGGTTGGGTGG - Intronic
1069568805 10:69481699-69481721 TGATACAGACAGATGTTGTCGGG - Intronic
1080128076 11:28761246-28761268 TTATACTGGCAGATGTTCTGTGG - Intergenic
1081721983 11:45296335-45296357 TCAGGCAGGCAGAAGTTGAGAGG - Intergenic
1086977522 11:93152613-93152635 TCATGGAAGCAGATGTGGCGTGG + Intronic
1100857745 12:98773098-98773120 TGATATAGGCAAATGTTGAGAGG + Exonic
1102904811 12:116666379-116666401 TCTTCCAGGCAGCTGTGGCGGGG + Intergenic
1103662132 12:122528712-122528734 GTATACAGGCAGATGTTCCTAGG - Intronic
1103681461 12:122697283-122697305 TCTTGCAGCCAGAGGTTGCGTGG + Intergenic
1104395698 12:128430525-128430547 TTATACAGGCATATGTTGTTTGG + Intronic
1108398229 13:50010899-50010921 GCATACCGGCAGATGTTGTCTGG - Intronic
1109648462 13:65292228-65292250 TCATATATACAGATGTTGAGTGG - Intergenic
1115644917 14:35362361-35362383 TCACCCAGGCAGATGATGCTGGG + Intergenic
1119431049 14:74568131-74568153 TCCTTCAGGCTGATGTAGCGTGG + Intronic
1123495984 15:20827421-20827443 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1123552472 15:21396513-21396535 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1123588715 15:21833910-21833932 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1132011453 15:98280190-98280212 CAATACAGGCTGATGTTTCGGGG - Intergenic
1202960818 15_KI270727v1_random:123744-123766 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1137565719 16:49531395-49531417 TCATCCAGGCAAATCTTGCCAGG + Intronic
1139366607 16:66437562-66437584 ACAAACAGGCAGGTGTTGGGGGG - Intronic
1143290280 17:5823000-5823022 GCAGACAGGCAGACGTTGAGAGG - Intronic
1149784040 17:59420827-59420849 ACCTACAGGCAGATGTTGAGGGG - Intergenic
1150840445 17:68601263-68601285 TCCTAGAGGCAGAGGTAGCGCGG + Exonic
1153893851 18:9541618-9541640 TCCCACAGGCAGATGCTGAGGGG - Intergenic
1154453390 18:14499925-14499947 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1156747490 18:40410032-40410054 TTAAACAGGTAGATGTTGGGTGG - Intergenic
1157729381 18:49990506-49990528 TCCTCCAGGCAGATGATGAGAGG - Exonic
1162823760 19:13238466-13238488 TCAGATAGGCAGGTGTTGTGGGG - Intronic
1167678418 19:50904096-50904118 TCTTACAGGGATATGTTGTGTGG - Intergenic
933146853 2:78864244-78864266 TCCTACAGGTAGAAGTTGCATGG + Intergenic
935236095 2:101139419-101139441 GGATGCAGGCAGATGTGGCGTGG - Intronic
939998228 2:148940351-148940373 TCAAGTAGGCAGATGTTGCTAGG + Intronic
948051963 2:234985300-234985322 TCATTAAGGCAGATGTTGGCAGG - Intronic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1176820797 21:13653362-13653384 TCATCCAGGCAGAAGTGGAGTGG + Intergenic
1179031002 21:37719263-37719285 GCATGCATGCAGATGTTGCAGGG + Intronic
1184727127 22:46353681-46353703 TCATGAAGGCAGATGCTGGGAGG - Intronic
950775905 3:15350208-15350230 TCATAGGGGCAGATGTTTCATGG + Intergenic
955952244 3:64254027-64254049 TAATACAGGTATATGTTTCGGGG + Intronic
958622858 3:96583974-96583996 CCATTCAGGCAGATGTTTTGGGG - Intergenic
963354194 3:144189623-144189645 TCACACAGGCAGATGTGTCCAGG - Intergenic
971469517 4:27006119-27006141 TTATGTAGGCAGATGTTGCTCGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
983973735 4:173906206-173906228 TCATACAGGCTGCTGTTCGGAGG + Intergenic
984707904 4:182861296-182861318 TCATACTGGCAGGGGTTGTGGGG + Intergenic
987246979 5:16059123-16059145 TGATAGAGGCAGAGGTTGGGGGG - Intergenic
989406726 5:41069427-41069449 TTATACAGGCAGATGTTGAAAGG - Intronic
991575758 5:68101830-68101852 ACATGCAGGCAGATGTTTTGTGG - Intergenic
992832092 5:80603641-80603663 ACATACTGGCAGTTGTTGCAAGG + Intergenic
995433566 5:112109731-112109753 TCATACTGGCAGATTTGGGGTGG - Intergenic
996492193 5:124110946-124110968 TCAAACAGGAAAATGTTGGGCGG + Intergenic
998576042 5:143317779-143317801 TCATTCAGGCAGACGTTTCCTGG + Intronic
1006084509 6:31586707-31586729 TCCCACAGGCAGATGCTGCTAGG - Intronic
1008358733 6:50588934-50588956 TCATACAGCCTGATGTTGTTGGG + Intergenic
1012544099 6:100396573-100396595 TCAAGCAGGCAGAAGTTGGGTGG + Intronic
1013394430 6:109720646-109720668 TCATGCACACAGATGTTGTGGGG + Intronic
1015082712 6:129247409-129247431 TCATTCAGGCTGATGTGGAGTGG - Intronic
1027731313 7:81876897-81876919 TCCTACAGGCATTTGTTGTGTGG + Intergenic
1035889977 8:3332758-3332780 TCTGACGGGCAGATGTTGCAGGG + Intronic
1038501196 8:28045521-28045543 CCATACCGGCAGGTTTTGCGTGG + Exonic
1039570811 8:38585136-38585158 TCTTACATGCAGACGTTGGGTGG + Intergenic
1041344513 8:56882929-56882951 TCAAACAGGCAGATGTCCCCAGG - Intergenic
1045906357 8:107349967-107349989 TCATACAGGCAGTTGTTCTATGG - Intronic
1046592485 8:116222916-116222938 TCCTAGAGGCAGATGCTGCTGGG + Intergenic
1049228052 8:141467068-141467090 ACACACAGGCAGATGTTGCCTGG - Intergenic
1050176348 9:2873129-2873151 TCATAGAGGCAGATCTGGAGAGG + Intergenic
1203526560 Un_GL000213v1:96191-96213 TCATCCAGGCAGAAGTGGAGTGG - Intergenic
1186290019 X:8086880-8086902 TCAGACAGGCAGGTGCTGAGGGG - Intergenic
1186925325 X:14327402-14327424 TCATACAGGCAGGTTCTGCAGGG + Intergenic
1188894853 X:35654441-35654463 AAATACAGGCAGATTTTGCAGGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189836481 X:45028419-45028441 TCATATAGTCAGATTTTGCTTGG + Intronic
1193360087 X:80571384-80571406 TCCTACAGGCAGACGTGGGGAGG - Intergenic
1195888348 X:109665899-109665921 TCATACAGGGATATGCTGTGAGG + Intronic
1200690436 Y:6303369-6303391 ACATACCCGCAGATGTTGAGAGG - Intergenic
1200935251 Y:8732795-8732817 TCATACAGGCAGAATCTGCATGG + Intergenic
1201044837 Y:9871347-9871369 ACATACCCGCAGATGTTGAGAGG + Intergenic
1202602921 Y:26612955-26612977 TGAAGCAGGCAGATGTTGGGGGG - Intergenic