ID: 913112949

View in Genome Browser
Species Human (GRCh38)
Location 1:115672312-115672334
Sequence TGAATTTCAAACCAAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913112947_913112949 -1 Left 913112947 1:115672290-115672312 CCTGCAGGGCTTGTCCACAGCTT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 913112949 1:115672312-115672334 TGAATTTCAAACCAAAAGCCAGG 0: 1
1: 0
2: 0
3: 29
4: 266
913112946_913112949 0 Left 913112946 1:115672289-115672311 CCCTGCAGGGCTTGTCCACAGCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 913112949 1:115672312-115672334 TGAATTTCAAACCAAAAGCCAGG 0: 1
1: 0
2: 0
3: 29
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913112949 Original CRISPR TGAATTTCAAACCAAAAGCC AGG Intronic
900787382 1:4657186-4657208 TAAATTTCAAATCAAAAGAGAGG - Intronic
901237376 1:7674481-7674503 TGAAATTCAAAATGAAAGCCAGG + Intronic
902205084 1:14862500-14862522 TGACTTTCAAACCCCCAGCCTGG + Intronic
902621532 1:17653685-17653707 TGAATTTTACCCCAGAAGCCTGG - Intronic
904254009 1:29243196-29243218 AGCATTAGAAACCAAAAGCCTGG - Intronic
904303026 1:29568277-29568299 TGGATCTCTAACCCAAAGCCAGG + Intergenic
907877886 1:58511872-58511894 TGAATATGACACCAAAAGCACGG + Intronic
908506198 1:64802772-64802794 TGAATTTTAAAGCAAATTCCAGG + Intronic
908556837 1:65264832-65264854 TGAATGACAAATCAAAAGTCAGG + Intronic
912916131 1:113816611-113816633 TAAATTTCAACCCAGAAGCCAGG + Intronic
913112949 1:115672312-115672334 TGAATTTCAAACCAAAAGCCAGG + Intronic
915453013 1:156020084-156020106 TGATTTGGAAGCCAAAAGCCTGG + Exonic
917049074 1:170897940-170897962 TGAGCTGCAAAACAAAAGCCAGG + Intergenic
917776874 1:178347025-178347047 GGTATTTAAAACCAGAAGCCAGG + Intronic
918126500 1:181588621-181588643 TGAATTTCACACCACGAACCAGG + Intronic
919481223 1:198092155-198092177 TGTATCTCAAACTAAAATCCAGG + Intergenic
920295278 1:204952317-204952339 TTAAGTTCACACCAAAAGCCAGG + Intronic
920828086 1:209440739-209440761 TGGATTTAAAACCAAAGGGCAGG + Intergenic
921319140 1:213920225-213920247 TGCATTTCAAACCACCTGCCAGG - Intergenic
922851017 1:228734383-228734405 TGAGCTTCTAACCAAAATCCTGG - Intergenic
924488783 1:244514125-244514147 TGGATATGACACCAAAAGCCCGG - Intronic
1064225030 10:13475010-13475032 TGAATTTCGAACCAACACCCAGG + Intronic
1064442852 10:15370099-15370121 TGATTTTAAAAACAAAAGACAGG + Intronic
1065869628 10:29945373-29945395 TGATGTTCAAACCAAAACCCAGG - Intergenic
1067378691 10:45752426-45752448 TGAATTTCACACTAAACCCCTGG - Intronic
1067836608 10:49645434-49645456 TGAACTTTAAACCAAGAGGCAGG + Intronic
1067886388 10:50093106-50093128 TGAATTTCACACTAAACCCCTGG - Intronic
1068382517 10:56275193-56275215 TGAACTTCAAACAAAATGGCAGG - Intergenic
1069274254 10:66569256-66569278 TAAATTGCAAAGCAAAAGGCTGG - Intronic
1069929851 10:71874988-71875010 TGAATTTCAAACATGAAGCCAGG + Intergenic
1070459074 10:76646659-76646681 TAAATTTTAAACCAATCGCCAGG + Intergenic
1071257149 10:83880977-83880999 TCAACATCAAACCAAAAGCTTGG + Intergenic
1072057443 10:91774176-91774198 TTAAGTTCCAACTAAAAGCCTGG + Intergenic
1072777753 10:98217035-98217057 TGAATTTAAAACCAAAATGTTGG + Intronic
1072861653 10:99012034-99012056 TGAATTTCAAAGTAAAAGTAAGG - Intronic
1076117983 10:127913873-127913895 AGGATTTCAGACCAAAAGGCTGG - Intronic
1078149770 11:8748583-8748605 GCAACTTCACACCAAAAGCCAGG + Intronic
1078411277 11:11121543-11121565 GCCTTTTCAAACCAAAAGCCAGG - Intergenic
1078561826 11:12378647-12378669 TCGTTTTCAAACCAAAAACCAGG - Intronic
1079722239 11:23831759-23831781 TAAATTTGAAAACAAAATCCAGG + Intergenic
1080066861 11:28027406-28027428 AGCACTGCAAACCAAAAGCCGGG - Intronic
1081286812 11:41280441-41280463 TTTATTTCAAAGTAAAAGCCTGG + Intronic
1082144923 11:48655212-48655234 AGAATTTTAAACCAATATCCCGG - Intergenic
1084390408 11:68872106-68872128 TGAATCTCAAACCAAGTCCCAGG - Intergenic
1086338805 11:85826470-85826492 TGAATTTCAGACCAGGAGCCTGG + Intergenic
1087066348 11:94031542-94031564 TGATTTTGATAGCAAAAGCCTGG - Intronic
1087245684 11:95833577-95833599 TCAAATTCAAATCAAAAGCCAGG - Exonic
1087563936 11:99829392-99829414 TTATTTTCAAACATAAAGCCTGG - Intronic
1088855739 11:113751573-113751595 GGAATTTTAAAACAAAAGGCTGG + Intronic
1090586810 11:128221970-128221992 TACATCTCAAGCCAAAAGCCTGG - Intergenic
1091538522 12:1436790-1436812 TGGATTTCAAAGGAAAAGCTAGG - Intronic
1091876193 12:3935281-3935303 TGAATAGGAAACCAAAAGCACGG + Intergenic
1092857380 12:12687270-12687292 TGGCTTTCAAAACAATAGCCTGG - Intronic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1097621020 12:61940008-61940030 TGTATTTAAAGCCAATAGCCTGG + Intronic
1097674877 12:62589544-62589566 GGAATTTCTAAGAAAAAGCCTGG + Intronic
1097924746 12:65114999-65115021 TTAATTTCAAACCAAACACCTGG - Intronic
1098769010 12:74528983-74529005 TGAAATTCAAATCTAAATCCTGG + Intergenic
1098804731 12:75009367-75009389 AGAATTTCAAACTCAAAGACAGG - Intergenic
1100518763 12:95353304-95353326 AGCATTCCAAACCAAAAGCCTGG + Intergenic
1100684162 12:96967440-96967462 TGAATTTTGAAGCTAAAGCCTGG - Intergenic
1102452456 12:113052162-113052184 TGAATTTCAGAGCAAGACCCTGG + Intergenic
1104256896 12:127146823-127146845 TGAACCTCAAGCCAAAGGCCAGG + Intergenic
1105901902 13:24762755-24762777 TGTATTTCAAACAAAACACCTGG - Intergenic
1106610383 13:31273811-31273833 AGATTTTGCAACCAAAAGCCAGG - Intronic
1107555326 13:41512819-41512841 TGAATTTCCAACCAGAAGCAAGG + Intergenic
1107566866 13:41613897-41613919 TCAATTGAAAACTAAAAGCCAGG + Intronic
1108261172 13:48658283-48658305 TGAAATTCAAATCTAAAGTCTGG - Intronic
1108272690 13:48777521-48777543 TGAATGAGAAACCAAAACCCAGG - Intergenic
1109069937 13:57751693-57751715 TGCATTTCAAAACAAAATCCTGG - Intergenic
1110135480 13:72062465-72062487 TGGATTTCAAGCCAAAAACTGGG + Intergenic
1110327601 13:74235784-74235806 TTAATTTAAAACAAAATGCCAGG - Intergenic
1110472456 13:75875328-75875350 TAAATTTCAAAAGAAAAGGCAGG + Intronic
1111689558 13:91545399-91545421 TGAACTTAAAACCAAAAGATGGG - Intronic
1111792337 13:92873685-92873707 CAAATTTCAAATAAAAAGCCTGG - Intergenic
1113164608 13:107424696-107424718 CTAACTTCAAACCAAAAGCATGG + Intronic
1114068026 14:19082523-19082545 TGGATATCACACCACAAGCCAGG + Intergenic
1114094237 14:19317498-19317520 TGGATATCACACCACAAGCCAGG - Intergenic
1114799168 14:25752937-25752959 TGAATTTTTAACCTAATGCCTGG - Intergenic
1115854736 14:37618839-37618861 TCAATAGCAAACCAAAGGCCTGG + Intronic
1116267604 14:42714027-42714049 TGATTTTCAAAGAAAATGCCAGG + Intergenic
1116486071 14:45450731-45450753 TGAATTTAAAAACATAATCCAGG - Intergenic
1118419788 14:65589387-65589409 TGAATATCAAAGCAAAGGTCTGG - Intronic
1119653942 14:76403383-76403405 TTGATTTCAAACCACATGCCTGG - Intronic
1120702727 14:87715572-87715594 TCAATTTCAAACCATAAGGCAGG + Intergenic
1122082607 14:99275774-99275796 AGAATTTTAAACAAAAAGCCTGG - Intergenic
1123177318 14:106432818-106432840 TGAATTTAATACCAAAACACAGG + Intergenic
1125012322 15:34892943-34892965 TAAAAGTCAAACCAAAAGTCAGG + Intronic
1126550511 15:49923847-49923869 TGAATTTCACACCAGGAGACAGG - Intronic
1127383574 15:58449837-58449859 TGCATTTAAAACCCAAGGCCGGG - Intronic
1133490484 16:6263219-6263241 TGGATTTCAAACAAAATTCCTGG - Intronic
1134151343 16:11807580-11807602 TGAATGTTAAATCAAAATCCTGG + Intergenic
1134384019 16:13755185-13755207 CGTTTTTCAAAACAAAAGCCAGG + Intergenic
1135792125 16:25406724-25406746 TTCATTTGAAACCAAAAGACTGG + Intergenic
1135903003 16:26483762-26483784 TGGATATGACACCAAAAGCCTGG + Intergenic
1137468855 16:48736469-48736491 TTAATTCCAAACCAGAGGCCTGG - Intergenic
1140818787 16:78644433-78644455 GTATTTTCAAACCAAAAACCTGG + Intronic
1143492288 17:7291463-7291485 TGAACTCCAAAGCAAAAGGCAGG + Intronic
1144110624 17:12028001-12028023 AAAATGTCCAACCAAAAGCCTGG - Intronic
1144592999 17:16540591-16540613 TGGATTTCATACCAAAAGGAAGG + Intergenic
1145218874 17:21072644-21072666 TGTTTTTCAAACCACAAGTCAGG - Intergenic
1147014481 17:37480314-37480336 AGAAATTCAAACAAAAAGCTAGG - Intergenic
1148956790 17:51360843-51360865 CTCATTTCACACCAAAAGCCAGG - Intergenic
1149371671 17:56000569-56000591 AGAATTTGAAACCACAAGCCAGG - Intergenic
1153587127 18:6634009-6634031 GGAATTTCAAACACTAAGCCAGG - Intergenic
1154108534 18:11546482-11546504 TGGATCTCAAACCAAATCCCAGG + Intergenic
1154936213 18:21060538-21060560 TGAATTTCAAACTAAATTCATGG + Intronic
1155198472 18:23497161-23497183 TGAAAATCAAATCAAAAGCAGGG + Intergenic
1156316634 18:35974965-35974987 TGCGTCTCAAACCCAAAGCCAGG + Exonic
1157608995 18:48944308-48944330 TGTGTTTCAAAGGAAAAGCCGGG + Intronic
1157675813 18:49567935-49567957 GGAATTTCAGATCACAAGCCTGG - Intronic
1158093929 18:53748776-53748798 TGAATTTCAGATCAGCAGCCTGG + Intergenic
1158154955 18:54415358-54415380 TTCATTTCAAACCTGAAGCCTGG + Intergenic
1158370175 18:56792357-56792379 TGAATTCCCAACCAATAACCTGG - Intronic
1158898915 18:61943200-61943222 TGAATTTCAATTAAAAAGCAGGG - Intergenic
1159467573 18:68804444-68804466 TGAATTTGAAGTCAAAGGCCTGG + Intronic
1159670680 18:71217199-71217221 TGAATTTAAACTCAAAAGACAGG + Intergenic
1159726508 18:71967347-71967369 TTAATTACAAAGCAAAAGCTGGG + Intergenic
1160337188 18:78053273-78053295 TGCATTTCAAAGCAAAAACTAGG + Intergenic
1160414526 18:78698923-78698945 TGAATTTGAAACCAAAACAAAGG - Intergenic
1161114388 19:2488653-2488675 GGAGATTCAAACCTAAAGCCAGG - Intergenic
1163246103 19:16095426-16095448 TGACGTTCAAACCAGAAGGCAGG - Intronic
1164148653 19:22529690-22529712 TGAATTTTAAACCAAGTCCCAGG - Intronic
1165399296 19:35587440-35587462 GGAATTTTAAACCAAAAAACTGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166642140 19:44502439-44502461 TAAATTTCAAAACAAAAGTAGGG + Intronic
926365871 2:12132768-12132790 TGAATCTGAATCCAAAGGCCAGG - Intergenic
927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG + Intergenic
928095292 2:28401025-28401047 TGCATTTCAAACCCAGAACCTGG + Intronic
928739402 2:34332230-34332252 TGTAATGCAAACCAGAAGCCGGG - Intergenic
929047236 2:37801956-37801978 TGTATTTCCAATCAAAAGTCAGG + Intergenic
930125284 2:47791532-47791554 TGAGTTTCACACCAAACTCCTGG + Intronic
930209955 2:48625905-48625927 TGGATATCACACCAAAAGCTCGG - Intronic
930256043 2:49092959-49092981 TGAAATTCAAAACCAAAGCTGGG - Intronic
930403530 2:50923618-50923640 TGAATTTAAAATAAAAAGCTAGG - Intronic
932386190 2:71334990-71335012 TTCTTTTCAAACCAAAACCCTGG - Intronic
933115774 2:78469375-78469397 TTAATTAAAAAACAAAAGCCAGG - Intergenic
936652800 2:114448972-114448994 TGAATTTAAAACAAAAAGCAAGG - Intronic
936797298 2:116223100-116223122 TATATGTGAAACCAAAAGCCTGG + Intergenic
936804336 2:116309403-116309425 TGAATTTTCAACCAACATCCAGG - Intergenic
937452251 2:122011240-122011262 TGATTTTCAAACCAAAGACCTGG - Intergenic
941850172 2:170172508-170172530 AGAAATTCAATCCAAAAGCCAGG - Intergenic
942856339 2:180554097-180554119 TGAATGTGACACCAAAAGCACGG + Intergenic
943254171 2:185572312-185572334 TGAAATTTAAACTAAAAACCAGG + Intergenic
943487941 2:188511411-188511433 TGAATAGAAAACCAAAAGCATGG - Intronic
943544361 2:189256432-189256454 TGAATTTCAAAGGAGAAACCAGG + Intergenic
943834602 2:192502881-192502903 GGATTTTCAAACCAAAGGCAAGG - Intergenic
946746595 2:222852834-222852856 TGAATTTCAAAGAAAGAGTCAGG - Intergenic
1169152255 20:3298810-3298832 TGAATGTGATACCAAAAGCACGG - Intronic
1169611889 20:7390232-7390254 TGAAATTCAAGCCAAATGACCGG - Intergenic
1169631272 20:7635149-7635171 TGTGTCTCAAAACAAAAGCCTGG - Intergenic
1170202851 20:13763214-13763236 AGTATTTCCAACCATAAGCCTGG + Intronic
1172186434 20:33034014-33034036 TGAAATGCAAAACAAAAGGCTGG - Intronic
1176069503 20:63218749-63218771 TGGAGTTCACAGCAAAAGCCTGG - Intergenic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1178754315 21:35333962-35333984 TGAAATTCAAGCCAAAATGCTGG - Intronic
949424837 3:3905895-3905917 TGAAGTTTAAACCCAAGGCCAGG + Intronic
950651928 3:14412681-14412703 TGAATTTCTAACCAAATCCCAGG + Intronic
954152213 3:48663201-48663223 AAAATTTCAGACCAAAATCCGGG - Intergenic
955721839 3:61890731-61890753 TGGATTTCAAACCTGAAGGCTGG - Intronic
956253350 3:67257563-67257585 GGAATTTGATACCAAAAGACAGG + Intergenic
957936512 3:86950922-86950944 TGAATTTCAAACTCAAACTCTGG - Intronic
957965055 3:87311644-87311666 AGAATTTGAAACTATAAGCCAGG + Intergenic
958134822 3:89475258-89475280 TCAAATTCAAACAATAAGCCAGG - Intronic
958496713 3:94853141-94853163 TCAATTTCAAACCAACAGGAGGG + Intergenic
958802131 3:98768392-98768414 TGAAGTCCAAAGCAAAGGCCAGG - Intronic
960085613 3:113587882-113587904 AGAATGCCAGACCAAAAGCCTGG + Intronic
961862948 3:129932231-129932253 TGAATTTCAAAAAATTAGCCAGG - Intergenic
962526980 3:136245878-136245900 TGAATTTCAGAGCAACAGCTGGG - Intergenic
963501494 3:146132876-146132898 TGAATTTTAAAATAAAAGCCTGG + Intronic
963614604 3:147519925-147519947 GTAATTTCTTACCAAAAGCCAGG + Intergenic
964278300 3:155032544-155032566 TGAATCTCAAATCAAAATCAGGG + Intronic
965650700 3:170929858-170929880 GGAAATTCAAACCAAAGGCAAGG - Intergenic
968032424 3:195511758-195511780 TGATTTTTAACACAAAAGCCTGG - Intergenic
971389026 4:26168999-26169021 GGAAATTCAAACCAAAGGCAAGG - Intronic
971436683 4:26633514-26633536 TTGTTTTAAAACCAAAAGCCTGG + Intronic
973929528 4:55777262-55777284 TGGATATCACACCAAAAGCTCGG + Intergenic
975540122 4:75500871-75500893 TGATTTTCAAACAAAAATACAGG + Intronic
975635852 4:76447188-76447210 TGAATTTGAAGTCAAAACCCAGG + Intronic
976732571 4:88279024-88279046 TGCATTTCTAACCAACACCCTGG + Intronic
976868008 4:89754132-89754154 TGAATATCAAACAAATTGCCTGG + Intronic
977099225 4:92788080-92788102 GGAATTTCAAACCATGAGCTTGG + Intronic
979142672 4:117197727-117197749 TGAATTTAAAACCATAATCCTGG + Intergenic
980800493 4:137742932-137742954 TGAAAATCAAAAGAAAAGCCTGG + Intergenic
981151013 4:141378981-141379003 GGAAATTCAAACCAAAGGCAAGG + Intergenic
981982922 4:150817317-150817339 TGAATTTCAAAACAGAAACTAGG + Intronic
983226188 4:165088316-165088338 TTAATTTCAAACCAACAGGAAGG - Intronic
983264014 4:165488316-165488338 TGACTTTCAGAACAGAAGCCTGG + Intronic
983334053 4:166369928-166369950 TGAATCATAAATCAAAAGCCTGG - Intergenic
985235052 4:187863280-187863302 TGCATTTCAAACTGAATGCCTGG - Intergenic
986451582 5:7869965-7869987 TGAAACCCAAACCAAAAGCTTGG - Intronic
986818203 5:11435861-11435883 TGAATTTGAAAGCAAGAGCTGGG - Intronic
987149487 5:15024249-15024271 TGAGTTTCCCACCATAAGCCAGG - Intergenic
987229678 5:15880638-15880660 TGGATTGCAAACAAAAAACCTGG + Intronic
987813690 5:22872649-22872671 TATATATGAAACCAAAAGCCTGG + Intergenic
988401178 5:30762478-30762500 TGAAATACAAACAAAAGGCCAGG + Intergenic
989664371 5:43836219-43836241 TGATTTTAAAAGCAAATGCCAGG + Intergenic
990291196 5:54353943-54353965 TGAATTTCTCACCAAAAACTAGG - Intergenic
991446451 5:66705076-66705098 TGAATTTCCATCCAAAAACTAGG - Intronic
991621656 5:68551235-68551257 TGAATTTCAGAGCTAAAGCCTGG - Intergenic
993066094 5:83099018-83099040 TAAATTGCAAACCAAAAGTGTGG - Intronic
995391997 5:111649894-111649916 TATTTTTCAAAGCAAAAGCCTGG - Intergenic
995606977 5:113867395-113867417 TGAACTTCATACCAGAAGCAGGG + Intergenic
996850941 5:127951471-127951493 TGCATTACAAACCAAATGCATGG + Intergenic
998023390 5:138790836-138790858 TGAAGGTCAAACCAAATGGCAGG - Intronic
998782604 5:145674735-145674757 GGAATTTGAGACCAAAAGCCTGG + Intronic
999975708 5:156909999-156910021 TGAATTCCAAGCACAAAGCCAGG + Intergenic
1000204837 5:159048816-159048838 TGAATTCCACACCAAAAACAGGG + Intronic
1000385205 5:160668784-160668806 TGAATTTCACAGCAAAACCATGG + Intronic
1000406351 5:160892390-160892412 TTAATTTGAAAACAGAAGCCTGG - Intergenic
1000712204 5:164594930-164594952 TGAATTTCAAAGGAAAAATCTGG - Intergenic
1001233014 5:170006035-170006057 GGAATTTGAAACAACAAGCCAGG - Intronic
1001728238 5:173926606-173926628 AGAATTTGGAACCAGAAGCCTGG - Intronic
1002348672 5:178566372-178566394 CCAATTACAAACCAAAAGTCAGG + Intronic
1002995016 6:2274770-2274792 TGTATTTCAAACATAAAGTCGGG - Intergenic
1003230674 6:4250388-4250410 TAAATTTCAATCCAGAAGCAAGG - Intergenic
1004085300 6:12441941-12441963 TGGAAGTCAAACCTAAAGCCTGG - Intergenic
1004245024 6:13966460-13966482 TGAGTTAAAAACCAAAACCCAGG + Intronic
1004303765 6:14481172-14481194 GGAAATTCAAACCAAAGGCAAGG + Intergenic
1004431381 6:15547371-15547393 TGCATTTCTAACCAAACCCCAGG + Intronic
1004653111 6:17631289-17631311 TTGATTGCAAACCAAAAGTCAGG - Intronic
1004684745 6:17932245-17932267 TGATTTTCAAAATATAAGCCTGG - Intronic
1006749842 6:36370107-36370129 TCATTTCCAACCCAAAAGCCAGG + Intronic
1007095966 6:39213354-39213376 TCAATTTAAAAACAGAAGCCAGG - Intronic
1008528020 6:52427169-52427191 TGATTTTCAAAAAATAAGCCTGG - Intronic
1008706053 6:54160451-54160473 GGAATTGCATACCAAAAGCAGGG - Intronic
1009353865 6:62715286-62715308 TGAATTTCTCACCAAAAATCAGG + Intergenic
1009950035 6:70384886-70384908 TGGATATCACACCAAAAGCTCGG - Intergenic
1012603258 6:101125541-101125563 AGAATTTATAAACAAAAGCCAGG - Intergenic
1013562919 6:111324291-111324313 TTAATTTAAAACCTAAGGCCAGG - Intronic
1014441577 6:121479714-121479736 TGATTTTCAAAACAAAAACAAGG - Intergenic
1014781232 6:125567326-125567348 TGAATTTCAACCCAAAAAGATGG + Intergenic
1016574179 6:145549283-145549305 TAAATTTCAAACCAAAAATAAGG - Intronic
1017941388 6:159056302-159056324 GGCATTTCAAATAAAAAGCCAGG + Intergenic
1017950070 6:159128956-159128978 TGAAGTCCAAGCCAAAAGGCAGG + Intergenic
1018010607 6:159666625-159666647 TAAATTTCTAACAATAAGCCAGG + Intergenic
1018043782 6:159948242-159948264 TGAATCTCAAACCAAAAATCAGG - Intergenic
1018410203 6:163537603-163537625 AGAATTCCAAACCAAAAGACTGG - Intronic
1018582821 6:165322327-165322349 TGATTTTCAGTCCAAGAGCCAGG - Intergenic
1022955054 7:35373068-35373090 AGAAATTCAAGCCAAAGGCCTGG + Intergenic
1024709290 7:51997049-51997071 GTAATTTCAAAACAAAAGACAGG + Intergenic
1024962477 7:54991911-54991933 CGAATTTCAAACCAAAATGAGGG + Intergenic
1025535404 7:61941618-61941640 TGCAGATCAAACCAAAAGACCGG - Intergenic
1025784937 7:64635600-64635622 TGAATCTCACACCCAAAGGCAGG + Intergenic
1025823472 7:64992743-64992765 TGAATTTCAAACCAGGTCCCAGG + Exonic
1029066765 7:97857549-97857571 AGGATTTCAAACCACAAGTCAGG + Intronic
1029208596 7:98885950-98885972 TGCATCTGAGACCAAAAGCCAGG - Intronic
1031102218 7:117495278-117495300 TAAAAATCAAACCAAAATCCTGG + Intronic
1031134207 7:117868274-117868296 TGATTTTCAAATGAAAAGGCTGG + Intronic
1031687644 7:124751076-124751098 TCAATTTGAAAACAGAAGCCTGG - Intronic
1031814956 7:126422103-126422125 TGAATTTAAAACCAAAGACCTGG + Intergenic
1033912542 7:146282480-146282502 TGAAATCCAAACCAAAAGTTAGG + Intronic
1033971915 7:147051891-147051913 TAAATTTCAAACAAACAGCTTGG - Intronic
1034088891 7:148345746-148345768 TGAAGATCCAACCCAAAGCCAGG - Intronic
1034396888 7:150833163-150833185 TGAATTACAACCCAAAGCCCAGG + Intronic
1039708507 8:40031921-40031943 TGAATTTCAAAGTAACAGCAAGG - Intergenic
1041015179 8:53585795-53585817 GCAATTTCACTCCAAAAGCCAGG - Intergenic
1041647184 8:60264987-60265009 TGAATGTCAAAAAAAAAGACTGG + Intronic
1042572617 8:70183342-70183364 TGAATGTCAACTCAAAAGCAAGG + Intronic
1043033330 8:75167130-75167152 CGAATTTCAAACCAAAATTTTGG - Intergenic
1044482381 8:92706692-92706714 TGAATTTAAAACCAAAAATGGGG - Intergenic
1045476431 8:102556702-102556724 TCAGTATCAACCCAAAAGCCTGG + Intronic
1046517813 8:115286212-115286234 TTAAGTGCAAAGCAAAAGCCAGG - Intergenic
1047374172 8:124280605-124280627 AGAATTTAAAACAAAAAACCAGG + Intergenic
1048389699 8:133950550-133950572 TGAATATGACACCAAAAGCATGG + Intergenic
1052155542 9:25184177-25184199 TGAATGTGAAAACAAGAGCCAGG + Intergenic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1052917510 9:33934901-33934923 CAAATGTCAAACCAAAATCCTGG + Intronic
1053147626 9:35722656-35722678 TGAATTGCACAGCAAAAGCAGGG + Intronic
1055408753 9:76004208-76004230 TGTTTTACAAACCATAAGCCTGG - Intronic
1055910471 9:81344817-81344839 TGAATTTCAAACCAAAGTGTAGG + Intergenic
1056596251 9:88010148-88010170 TGAATGTGATACCAAAAGCATGG + Intergenic
1056859400 9:90165940-90165962 TGGATTTCACACCAAAAACCAGG - Intergenic
1056977933 9:91277427-91277449 TATATCTCAAACTAAAAGCCAGG + Intronic
1057074716 9:92132433-92132455 CGAATTTCAAAAAGAAAGCCTGG - Intergenic
1058804230 9:108575335-108575357 TAATTTTCAAAGCAAAATCCAGG + Intergenic
1060071100 9:120548453-120548475 TAATTTCCAAACCAAAAGTCAGG + Intronic
1060313637 9:122488026-122488048 TTAACTTCAAACCTAAAGCCTGG + Intergenic
1061508059 9:131043327-131043349 TGAATGTCAGACACAAAGCCAGG - Intronic
1187397482 X:18931064-18931086 TGCATATTAAAACAAAAGCCTGG + Intronic
1189006713 X:37003137-37003159 TGAATTTCTAACCTACAACCAGG - Intergenic
1189102444 X:38205521-38205543 TGAATATGACACCAAAAGCATGG - Intronic
1190923645 X:54881991-54882013 GGAAATTCAAACCAAAGGCAAGG - Intergenic
1191087608 X:56586449-56586471 GGAAATTCAAACCAAAGGCAAGG - Intergenic
1191092435 X:56637215-56637237 GGAAATTCAAACCAAAGGCAAGG + Intergenic
1192283362 X:69707522-69707544 TAAATTTTAAACCAAAAACAAGG - Intronic
1193399719 X:81028037-81028059 GGAAATTCAAACCAAAGGCAAGG + Intergenic
1193804138 X:85973003-85973025 TGAAAATCAAACCATAGGCCGGG + Intronic
1196560478 X:117141400-117141422 TGAATGCCTAACCCAAAGCCTGG - Intergenic
1196638600 X:118032804-118032826 GGAAATTCAAACCAAAGGCAAGG + Intronic
1200892103 Y:8335091-8335113 TGACTCTCATACCAGAAGCCAGG + Intergenic
1200896022 Y:8376901-8376923 TGACTTTCATACCAGAAGCCAGG - Intergenic
1201544649 Y:15148392-15148414 GGAAATTCAAACCAAAGGCAAGG - Intergenic
1202264670 Y:23005668-23005690 TGACTTTCATACATAAAGCCAGG + Intergenic
1202417661 Y:24639410-24639432 TGACTTTCATACATAAAGCCAGG + Intergenic
1202453125 Y:25030676-25030698 TGACTTTCATACATAAAGCCAGG - Intergenic