ID: 913116305

View in Genome Browser
Species Human (GRCh38)
Location 1:115700773-115700795
Sequence AACTGATGTTCGAGGTATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913116295_913116305 18 Left 913116295 1:115700732-115700754 CCTTCTCTAAGAAGGATCATCTT 0: 1
1: 0
2: 1
3: 8
4: 197
Right 913116305 1:115700773-115700795 AACTGATGTTCGAGGTATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
913116293_913116305 29 Left 913116293 1:115700721-115700743 CCAAGGCTGAGCCTTCTCTAAGA 0: 1
1: 0
2: 0
3: 11
4: 171
Right 913116305 1:115700773-115700795 AACTGATGTTCGAGGTATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913116305 Original CRISPR AACTGATGTTCGAGGTATGG AGG Exonic
900892688 1:5460970-5460992 GACTGATGTTGGAGTGATGGGGG + Intergenic
908616198 1:65925543-65925565 AGATGTTGTTGGAGGTATGGAGG - Intronic
913116305 1:115700773-115700795 AACTGATGTTCGAGGTATGGAGG + Exonic
914760782 1:150596346-150596368 AACAGTTGTTCTAGGTATTGAGG - Intergenic
920445568 1:206013637-206013659 TACTGTGGTTGGAGGTATGGAGG - Intronic
923869456 1:237975049-237975071 CACTGATGTTCTAGGTATTCAGG + Intergenic
1071003036 10:80852670-80852692 AACTAATGATCGTGGTTTGGTGG - Intergenic
1073540931 10:104315740-104315762 TCCTGATGATCGAGGTGTGGCGG - Exonic
1081694025 11:45097141-45097163 TGCTGAAGTTGGAGGTATGGGGG - Intronic
1084718649 11:70890052-70890074 AAGTGATGTTTGAAGGATGGTGG - Intronic
1087834052 11:102852536-102852558 AACTGATGATCAATATATGGTGG - Intergenic
1098328181 12:69324305-69324327 AACTGAAGGTCCAGGTATGGTGG + Intergenic
1100814689 12:98375033-98375055 AAATGATCTACGAGGGATGGCGG - Intergenic
1109903418 13:68805639-68805661 AACTAATGTTCCAGGTATGTTGG - Intergenic
1110564787 13:76947244-76947266 ACCTGTTGTTCTAGATATGGTGG - Intergenic
1111260654 13:85735842-85735864 AACTCATGTTTGTGGTATGCTGG + Intergenic
1113946157 13:114044651-114044673 AACTGAGGTTCGTGTTGTGGGGG - Intronic
1122213020 14:100185131-100185153 CACTGATGATCCAGGCATGGTGG - Intergenic
1127248546 15:57205427-57205449 AACTCATGTTCAAGATCTGGAGG - Intronic
1129756674 15:78103120-78103142 CACTGGTGTCCGAGGTAGGGTGG - Intronic
1132628911 16:907112-907134 AACTGATTTGCCAGGTGTGGTGG + Intronic
1134804100 16:17110120-17110142 AACTGAGGTACAAGGCATGGAGG - Intronic
1136985826 16:35103275-35103297 AAATGATGTACCAGGTGTGGTGG + Intergenic
1137242875 16:46673256-46673278 AAATGATGTGCCAGGTGTGGTGG - Intronic
1142570956 17:873902-873924 AGCTGATGTTGGAGAAATGGAGG - Intronic
1144690057 17:17255550-17255572 AACTGATGGGCGAGGGGTGGTGG + Intronic
1149396676 17:56252485-56252507 AATTGATGGACCAGGTATGGTGG + Intronic
1149396710 17:56252770-56252792 AATTGATGGACCAGGTATGGTGG + Intronic
1165352980 19:35286701-35286723 AGCAGATGAGCGAGGTATGGGGG - Intergenic
926000031 2:9323237-9323259 TACAGATGTGCGAGGTAAGGCGG + Exonic
927985105 2:27404655-27404677 AACTGATGGGCCAGGCATGGTGG + Intronic
931358510 2:61557824-61557846 AAAAGATGTGCCAGGTATGGTGG + Intergenic
936699630 2:114995345-114995367 AACTACTGTTCTAGGAATGGGGG - Intronic
942130215 2:172871282-172871304 CACTGATTTTTGAGGTGTGGAGG + Intronic
943808845 2:192158996-192159018 ATCTGAAGTTCCATGTATGGAGG + Intronic
1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG + Intergenic
951677231 3:25255354-25255376 TAATGATGTTCAAGGTATGAGGG - Intronic
953099759 3:39812439-39812461 AACTAATGATCAAGGTGTGGTGG - Intronic
955643833 3:61115102-61115124 AACTGTTGTTCTAGGTGTTGGGG + Intronic
956137474 3:66113301-66113323 AAATGATGTTCGGGGTTTGTTGG + Intergenic
958784562 3:98583616-98583638 GACTGATGTTCAAGGTCTGGGGG + Intronic
963107371 3:141658854-141658876 AACTTATGTGCCAGATATGGAGG + Intergenic
971240867 4:24887666-24887688 AACAGAGGTTCCAGGCATGGAGG - Intronic
978279992 4:106999681-106999703 AATTGATGCTGGAGGCATGGTGG - Intronic
980023238 4:127734270-127734292 AACTGATTTTCTGGGTGTGGTGG + Intronic
980951329 4:139381041-139381063 AACTGATGAAATAGGTATGGAGG - Intronic
981926646 4:150147718-150147740 AACTGATGCTGGAAGTATGCAGG + Intronic
983085663 4:163441547-163441569 TTCTGCTGTTGGAGGTATGGGGG - Intergenic
984159561 4:176234603-176234625 CACTGATGTGCTAGGTATTGAGG - Intronic
987831498 5:23101557-23101579 AACAGATGTTTGAGATATTGTGG - Intergenic
1004953362 6:20700200-20700222 AACTGATGAGCCAGGCATGGTGG + Intronic
1011934974 6:92765456-92765478 AAATGATGGGCCAGGTATGGTGG + Intergenic
1014574415 6:123052749-123052771 AACTGATGTTGGAGATAGGGAGG + Intronic
1017225874 6:152020736-152020758 AACTGATGGGCCAGGTGTGGTGG - Intronic
1017687731 6:156929864-156929886 AACAGATGATGGAGGAATGGAGG - Intronic
1019954166 7:4399801-4399823 AACAGGTGTTGGAGGAATGGTGG + Intergenic
1024049717 7:45610802-45610824 AGGTGATGGTGGAGGTATGGAGG + Intronic
1025293340 7:57751752-57751774 AAGAAATGTGCGAGGTATGGTGG - Intergenic
1026181151 7:68042035-68042057 AACAGTTGTTTGGGGTATGGGGG - Intergenic
1029789735 7:102829698-102829720 AACTGACCTTCGAGGTGAGGTGG + Intronic
1032465949 7:132145120-132145142 AATTGCTCTTCCAGGTATGGCGG + Exonic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1043860450 8:85310436-85310458 AACTGTTGATCCAGGCATGGTGG - Intergenic
1045049617 8:98310872-98310894 AAATGATATTCTGGGTATGGTGG - Intergenic
1059090934 9:111357099-111357121 AAATGATGTTGGAGGCCTGGGGG + Intergenic
1061642020 9:131966234-131966256 AACTGATTTGCCAGGCATGGTGG + Intronic
1187625897 X:21113485-21113507 AACTGATGTATGAGGTAAGTAGG - Intergenic
1188095759 X:26019143-26019165 AACTGATGTGGGAGTTTTGGGGG + Intergenic
1189419247 X:40841902-40841924 AATTGATGGTGGAGGTATGTAGG - Intergenic
1189766551 X:44378199-44378221 AACTGCTGTTGGAGGAGTGGGGG + Intergenic
1192487203 X:71538399-71538421 AATTGATTTTCAAGGAATGGTGG + Intronic
1194134263 X:90120466-90120488 AACGGATGTTCGTGTTTTGGAGG - Intergenic
1201864699 Y:18637437-18637459 AACTGATGTTAGAGGGTTTGGGG - Intergenic
1201868623 Y:18682941-18682963 AACTGATGTTAGAGGGTTTGGGG + Intergenic