ID: 913117697

View in Genome Browser
Species Human (GRCh38)
Location 1:115712022-115712044
Sequence GACACAAGGGTGAATAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913117689_913117697 10 Left 913117689 1:115711989-115712011 CCACAACATCTTAAGCCCAGAGC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG 0: 1
1: 0
2: 4
3: 24
4: 278
913117692_913117697 -6 Left 913117692 1:115712005-115712027 CCAGAGCCTGAGGCTGAGACACA 0: 1
1: 0
2: 2
3: 26
4: 334
Right 913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG 0: 1
1: 0
2: 4
3: 24
4: 278
913117691_913117697 -5 Left 913117691 1:115712004-115712026 CCCAGAGCCTGAGGCTGAGACAC 0: 1
1: 0
2: 1
3: 26
4: 317
Right 913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG 0: 1
1: 0
2: 4
3: 24
4: 278
913117688_913117697 11 Left 913117688 1:115711988-115712010 CCCACAACATCTTAAGCCCAGAG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG 0: 1
1: 0
2: 4
3: 24
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913117697 Original CRISPR GACACAAGGGTGAATAGGAC AGG Intronic
901191524 1:7413785-7413807 AACACTAGGTTGAATAGGAGTGG + Intronic
903972265 1:27126668-27126690 GAGTCAAAGATGAATAGGACAGG - Intronic
905099401 1:35505578-35505600 GATACAAAGGTGAATAAGAATGG - Intronic
905314359 1:37072129-37072151 GACACAATGGTGAACAAGACGGG - Intergenic
905342073 1:37286181-37286203 GACACAACAGTGAACAGGACGGG - Intergenic
905581969 1:39089076-39089098 GACAGAAGGGAGAAAAGGCCGGG + Intronic
905702747 1:40030886-40030908 GATACAATGGTGAATAAAACAGG - Intergenic
906671204 1:47656342-47656364 GACACCAAGATGAATAAGACAGG + Intergenic
907612304 1:55884283-55884305 GAGATAAGGGTGGATAGGAAGGG + Intergenic
908937297 1:69391477-69391499 AACACTATGGTGAATAGGAATGG + Intergenic
909120002 1:71590475-71590497 AAGAAAAGGGTGAGTAGGACTGG - Intronic
910835302 1:91502296-91502318 GACCTTAGGGTGAATAAGACAGG + Intronic
913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG + Intronic
913362777 1:118000850-118000872 GACACTATGTTGAATAGGAGTGG + Intronic
913412676 1:118570254-118570276 AACACTATGTTGAATAGGACTGG + Intergenic
913434764 1:118835535-118835557 AACACTATGTTGAATAGGACTGG - Intergenic
913614798 1:120547527-120547549 AATACAAGGATGAATAGCACAGG - Intergenic
914412190 1:147440600-147440622 GACAAAATGGTGACTTGGACTGG + Intergenic
914575473 1:148963380-148963402 AATACAAGGATGAATAGCACAGG + Intronic
915404019 1:155645394-155645416 ATCAGAAGGGTGAATAGGAGTGG - Intergenic
916250998 1:162738069-162738091 AACACAATGTTGAATAGGAGCGG - Intronic
916580616 1:166104316-166104338 AACACTATGTTGAATAGGACTGG - Intronic
918731036 1:187996531-187996553 AATACAAAGGTGAATAAGACAGG + Intergenic
919280771 1:195485794-195485816 GACTGAAGGGTGAGTAAGACAGG + Intergenic
920125319 1:203689695-203689717 GACACAAGGGTGAACATGACAGG + Intronic
920590246 1:207210850-207210872 AACACTATGGTGAATAGGAGTGG - Intergenic
921548977 1:216509938-216509960 GACACCAGGCTCAATAGAACTGG + Intronic
1062908375 10:1195210-1195232 GCCACAAGAGTGAACAGGAGAGG - Intronic
1064045247 10:12008173-12008195 GATACAAGGGGAAAAAGGACAGG + Intronic
1065107501 10:22405165-22405187 AACACAATGTTGAATAGGAGTGG + Intronic
1066307238 10:34157375-34157397 GAAACAAAGGTGAATATGACTGG - Intronic
1066598659 10:37079963-37079985 TACAGAATGGTGAATATGACAGG + Intergenic
1069116251 10:64510378-64510400 GACACAAGGGTAAATAAGAAAGG - Intergenic
1071244064 10:83743258-83743280 GACACTATGTTGAATAGGAGTGG + Intergenic
1073886929 10:108050131-108050153 GACACATCAGTGAATAAGACTGG - Intergenic
1074621979 10:115135148-115135170 AACACTATGTTGAATAGGACTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079765604 11:24388364-24388386 AACACTATGTTGAATAGGACTGG - Intergenic
1080239159 11:30106487-30106509 GAAACCAGTGTGAGTAGGACTGG - Intergenic
1080610397 11:33899205-33899227 GACACAGGGGTGAATAAGACAGG - Intergenic
1082196231 11:49309773-49309795 AACACTATGGTGAATAGGAGCGG + Intergenic
1083383669 11:62290788-62290810 GACACTATGTTGAATAGGAGTGG - Intergenic
1085001697 11:73043081-73043103 GCCACAACGCTGAATAGGAGTGG + Intronic
1086271126 11:85068263-85068285 AACACAATGTTGAATAGGAGTGG - Intronic
1086391981 11:86374787-86374809 GGCACCAGGGAGAATAGGCCCGG - Intronic
1086659596 11:89398429-89398451 AACACTATGGTGAATAGGAGCGG - Intronic
1087352697 11:97053746-97053768 AACACTATGTTGAATAGGACTGG - Intergenic
1087506773 11:99033797-99033819 AACACTATGGTGAATAGGAGTGG + Intronic
1087609172 11:100413024-100413046 AACACTAGGTTGAATAGGAGTGG - Intergenic
1088517335 11:110652349-110652371 GATACTATGTTGAATAGGACTGG - Intronic
1088946335 11:114517024-114517046 GACACAGCGCTGAACAGGACAGG - Intergenic
1089845125 11:121452368-121452390 GCGACCAGGGTGAATAGGAACGG - Exonic
1090059857 11:123454863-123454885 GACATATGTGGGAATAGGACTGG + Intergenic
1090126230 11:124087893-124087915 AACACAAGGCTCAAAAGGACTGG - Intergenic
1091151116 11:133328795-133328817 GACACTATGTTGAATAGGAGAGG - Intronic
1091763502 12:3103465-3103487 GACTCAGTGGTGAATCGGACTGG + Intronic
1091949485 12:4581061-4581083 GACCCAAAGGATAATAGGACTGG - Intronic
1092417633 12:8303095-8303117 AACACTATGTTGAATAGGACTGG + Intergenic
1092664406 12:10779387-10779409 GACCCTGGGGTGATTAGGACAGG + Intergenic
1095233700 12:39772177-39772199 GGCACAAGGGTCAAGAGCACAGG + Intronic
1098388354 12:69942648-69942670 AACACTATGTTGAATAGGACTGG - Intronic
1099107144 12:78510532-78510554 AACACAATGTTGAATAGGAGTGG - Intergenic
1099622337 12:85019554-85019576 GACAGAAGAGAGAATAGGTCAGG - Intronic
1100432794 12:94545791-94545813 GAGACGAGGGTGAAGAGGGCAGG + Intergenic
1100808661 12:98314901-98314923 GACACTAGGTTGAATAGGAGTGG - Intergenic
1101087970 12:101255526-101255548 GCCACTAGGGTTAATAGGCCTGG - Intergenic
1102928978 12:116848347-116848369 AACACAAGGGTCAAGAGGAAAGG - Intronic
1104870128 12:131989052-131989074 GACACCAGGCTGGATAGGGCAGG + Intronic
1109385545 13:61625006-61625028 AACACTATGTTGAATAGGACTGG + Intergenic
1111075126 13:83224922-83224944 GATACAAAGGTGAATGTGACAGG + Intergenic
1112411591 13:99168699-99168721 AACACTATGGTGAATAGGAGTGG + Intergenic
1115309128 14:31961819-31961841 GATACAAAGATGAATAAGACAGG + Intergenic
1116052499 14:39822056-39822078 AACACTATGTTGAATAGGACTGG + Intergenic
1116597168 14:46865503-46865525 AACACTATGTTGAATAGGACTGG - Intronic
1119449680 14:74698545-74698567 GTCACAAGGATAAATAAGACAGG + Intronic
1122030916 14:98911213-98911235 CACACAAGAGTGCAGAGGACTGG - Intergenic
1126257914 15:46649919-46649941 GACATAAGGGAGAAAAGCACTGG - Intergenic
1129768629 15:78187787-78187809 AACACAATGTTGAATAGGAGTGG - Intronic
1129967205 15:79747119-79747141 AACACTATGGTGAATAGGAGTGG + Intergenic
1130899341 15:88195340-88195362 GATACAATAGTGAATAAGACAGG - Intronic
1131064258 15:89423497-89423519 CACACCAGGGTGAATACAACAGG + Intergenic
1132000338 15:98173038-98173060 GAGACAAAGATGAATAGGACAGG + Intergenic
1133328374 16:4956282-4956304 AACACAAGGGTGAGTAGGTGGGG - Intronic
1133618159 16:7499149-7499171 GACAAAGGTGTGGATAGGACTGG + Intronic
1134139280 16:11703183-11703205 AACACCATGGTGAATGGGACAGG + Intronic
1135636590 16:24081524-24081546 GACATGATGTTGAATAGGACTGG - Intronic
1136088586 16:27902823-27902845 GACACATGCGGGAACAGGACAGG + Intronic
1136695515 16:32077254-32077276 GACACTATGTTGAATAGGAGTGG - Intergenic
1136796011 16:33020499-33020521 GACACTATGTTGAATAGGAGTGG - Intergenic
1136873910 16:33833899-33833921 GACACTATGTTGAATAGGAGTGG + Intergenic
1137032306 16:35534691-35534713 AACACTAGGTTGAATAGGAGTGG + Intergenic
1137494664 16:48960598-48960620 GACACAAGGGCCAAAAGCACTGG - Intergenic
1137522631 16:49208107-49208129 GACACAGAGGTGAACAGCACAGG + Intergenic
1137593614 16:49709078-49709100 GACATAAGGATGAACAAGACAGG + Intronic
1203098269 16_KI270728v1_random:1282157-1282179 GACACTATGTTGAATAGGAGTGG - Intergenic
1142942893 17:3397761-3397783 GACCCAAGGATGAGTAGGAATGG + Exonic
1142946427 17:3433165-3433187 GACCCAAGGATGAGTAGGAATGG + Exonic
1147338654 17:39741166-39741188 GACAAATGGGTGGATAGGACAGG + Intronic
1149240505 17:54643310-54643332 GACACTATGTTGAATAGGAGTGG - Intergenic
1150587455 17:66531710-66531732 GACACAGGTGTGAAAAGGAATGG - Intronic
1151231015 17:72685139-72685161 GACACAGGGGTGAATGAGACAGG + Intronic
1153445073 18:5162750-5162772 GACAGAAGTGTGAAGAGGAAAGG + Intronic
1154437437 18:14357676-14357698 GACAAAAGGGGGAAGAGGACAGG + Intergenic
1157183305 18:45517048-45517070 GACACAGAGGTGAATGAGACTGG + Intronic
1159227346 18:65556433-65556455 AACACAATGTTGAATAGGAGTGG + Intergenic
1162017606 19:7853820-7853842 GACACCAGGGTGTGTAGGGCAGG + Intronic
1163323305 19:16587150-16587172 GACACACGGGTGAATCAAACAGG + Intronic
1164575043 19:29400986-29401008 GGCACAAGGGAAAAAAGGACAGG + Intergenic
1164600119 19:29556496-29556518 AACACTATGGTGAATAGGAGTGG - Intronic
1165330968 19:35141072-35141094 GACAGGAGGGAGAATAGGAGAGG - Intronic
1165864747 19:38930103-38930125 GAGCCAAGTGTGAATCGGACGGG - Intronic
1166544145 19:43624100-43624122 GGCAGAAGGGTGAGTGGGACGGG - Exonic
1167081466 19:47278979-47279001 GACACAGGAGTGAATAAAACAGG + Intergenic
925334665 2:3086474-3086496 AACACTATGGTGAATAGGAGTGG - Intergenic
925884522 2:8383124-8383146 GATACAAAGGTGAATAGGACAGG + Intergenic
926116502 2:10217132-10217154 CAAAGAAGGGTGAATAGGAGAGG - Intergenic
926239999 2:11078144-11078166 GACACAGAGTTGAAGAGGACAGG + Intergenic
927831127 2:26351351-26351373 ATCACAAGGGTGAACAGGCCAGG - Intronic
930088374 2:47514389-47514411 GAGACAAGGGTGAGAAAGACAGG - Intronic
930248576 2:49010056-49010078 AACACTATGTTGAATAGGACCGG + Intronic
935672445 2:105567320-105567342 GACGCCTGGGTGAACAGGACAGG - Intergenic
935822995 2:106913275-106913297 AACACAATGTTGAATAGGAGTGG - Intergenic
940156729 2:150664515-150664537 GACTCAAGTGTGAAAAGGACAGG + Intergenic
940263254 2:151807660-151807682 GAAATTAGGGTGAATAGGATTGG - Intronic
940399034 2:153225455-153225477 ACTACAAGGGTGAATAGGAGTGG - Intergenic
942410248 2:175702065-175702087 GACACTATGTTGAATAGGAGTGG + Intergenic
943941215 2:194000574-194000596 GACACAAGGATGAACAGAATAGG + Intergenic
945935683 2:215900613-215900635 GACACAAGGGTGAAGCTAACGGG + Intergenic
946484413 2:220087459-220087481 AACACAAGGATAAATAAGACAGG - Intergenic
947836128 2:233176861-233176883 GACAGATGGATGAATAGAACTGG + Intronic
1169294459 20:4381744-4381766 GAAACGAGGGTGAACAGGGCTGG + Intergenic
1171520090 20:25769157-25769179 GACACTAGGGTGATTCAGACAGG + Intronic
1171556829 20:26087336-26087358 GACACTAGGGTGATTCAGACAGG - Intergenic
1174936657 20:54878031-54878053 GACACCAGGGTCAAGAGCACTGG + Intergenic
1176323027 21:5352722-5352744 AACACTATGTTGAATAGGACTGG - Intergenic
1176480681 21:7284342-7284364 AACACTATGTTGAATAGGACTGG - Intergenic
1176654222 21:9575433-9575455 GACACTAGGGTGATTCAGACAGG + Intergenic
1178958715 21:37044873-37044895 GACATAGTGGTGAATAGGGCAGG + Intergenic
1178967968 21:37142213-37142235 GACACTATGTTGAATAGGAGTGG - Intronic
1179171328 21:38975244-38975266 GCCACATGGCTGAATGGGACTGG - Intergenic
1181959017 22:26609702-26609724 GACGCATGGGTGAATAAGAAGGG + Intronic
1182397323 22:30045916-30045938 GACAAAAGGGAGAAAAGGAGAGG + Intergenic
1182404655 22:30115620-30115642 AACACAGGGGTGAATGGGATAGG + Intronic
1183162087 22:36121317-36121339 GTCACAAGGGAGAGAAGGACAGG + Intergenic
1183684077 22:39351415-39351437 GACACAAGGGTTAAAGGAACTGG - Intronic
950165215 3:10792360-10792382 GCCACAAGGGTGCATGGGATTGG - Intergenic
950470850 3:13185355-13185377 TACAGAAGGGGCAATAGGACAGG - Intergenic
950682705 3:14595947-14595969 GACTCAAGGAGGAATGGGACGGG + Intergenic
951403980 3:22271248-22271270 GAAAAAAGGATGAAGAGGACAGG + Intronic
951441277 3:22726747-22726769 GTAACAAGGGTGAAGAGGAGTGG - Intergenic
952074074 3:29674366-29674388 GACACTATGTTGAATAGGAGTGG - Intronic
952099805 3:29997881-29997903 AACACAATGTTGAATAGGAGTGG - Intronic
952677212 3:36047483-36047505 GACACATAGATGAATAGAACAGG - Intergenic
953045138 3:39288351-39288373 GATACAAAGATGAATAGGGCAGG + Intergenic
955221332 3:57025785-57025807 GATACATTGGTGAGTAGGACAGG - Intronic
955477776 3:59356818-59356840 AACACTAGGTTGAATAGGAGTGG + Intergenic
955886388 3:63603372-63603394 CACACAATGTTGAATAGGAGTGG + Intronic
957324880 3:78679288-78679310 AACACTAGGTTGAATAGGAGTGG - Intronic
957778693 3:84790057-84790079 GACAATAGGGTTAATAAGACAGG + Intergenic
957954729 3:87171226-87171248 AACAGAAGGATGAATAGGAATGG + Intergenic
958460194 3:94384721-94384743 AACACTATGTTGAATAGGACTGG - Intergenic
959044028 3:101451825-101451847 AACACAATGTTGAATAGGAGTGG - Intronic
960278558 3:115754999-115755021 AACACTATGGTGAATAGGAGTGG - Intergenic
960401777 3:117209055-117209077 AACACAATGTTGAATAGGAGTGG - Intergenic
960654271 3:119985299-119985321 AACACTATGTTGAATAGGACTGG - Intronic
962155827 3:132948036-132948058 AACACTATGTTGAATAGGACCGG + Intergenic
962641937 3:137396628-137396650 AACACTATGGTGAATAGGAGTGG - Intergenic
962913731 3:139879460-139879482 AACACAATGTTGAATAGGAGTGG + Intergenic
963714052 3:148782659-148782681 AACACTATGTTGAATAGGACTGG + Intergenic
967483829 3:190006867-190006889 GAAACAAGGTGGAACAGGACTGG + Intronic
968145277 3:196293229-196293251 GACAAAATGATGAATAAGACAGG - Intronic
970180700 4:13390020-13390042 AACACTATGTTGAATAGGACTGG - Intronic
970183199 4:13420868-13420890 AACACTATGTTGAATAGGACTGG - Intronic
970910281 4:21267377-21267399 GACACTATGTTGAATAGGAGTGG + Intronic
970957744 4:21834621-21834643 AACACTATGTTGAATAGGACTGG + Intronic
971092845 4:23364969-23364991 AATACAATGGTGAAGAGGACAGG - Intergenic
972859679 4:43152129-43152151 GACACTATGTTGAATAGGAGTGG - Intergenic
974841503 4:67304672-67304694 GAAATAAGGGTGAATAGAAGCGG + Intergenic
974997216 4:69176194-69176216 AACACAATGTTGAATAGGAGTGG - Intronic
975007836 4:69312620-69312642 AACACAATGTTGAATAGGAGTGG + Intronic
977017195 4:91706211-91706233 AACACTATGCTGAATAGGACTGG + Intergenic
977581227 4:98727372-98727394 AACACTATGTTGAATAGGACTGG - Intergenic
977633857 4:99272896-99272918 GACACAGGGCTGAAGAGGACAGG - Intergenic
977638545 4:99329055-99329077 GACACAAGGCTGAAGAGGATGGG - Intergenic
978105042 4:104892245-104892267 GACACAAGTATGAAAAGGTCTGG + Intergenic
978191152 4:105914005-105914027 GATACAAAGGTGAATAAAACAGG + Intronic
978904542 4:113990145-113990167 AACACTAGGTTGAATAGGAGTGG - Intergenic
979097322 4:116567157-116567179 AATACAATGGTGAATAGGATTGG - Intergenic
980144470 4:128964425-128964447 AACACAAGGGAGAACAGTACTGG + Intronic
980324805 4:131327852-131327874 GCCACATAGGTGAATATGACAGG - Intergenic
981151860 4:141387926-141387948 GGCACAAGGATGAATATGAGTGG - Intergenic
981262374 4:142736827-142736849 AACACTATGTTGAATAGGACTGG + Intronic
982718193 4:158830817-158830839 GACACAATGATGAACAGGACAGG - Intronic
983828700 4:172298382-172298404 AACACTATGGTGAATAGGAGTGG + Intronic
984324555 4:178235574-178235596 AATACTAGGTTGAATAGGACTGG + Intergenic
986075029 5:4327378-4327400 GACACCAGAGTGACTGGGACTGG - Intergenic
986428800 5:7661086-7661108 CAAACAAGGGTGATTTGGACAGG + Intronic
986498909 5:8377533-8377555 GACACTATGTTGAATAGGAGTGG - Intergenic
986754555 5:10823635-10823657 GACACAGGGGTGAAAGGAACAGG + Intergenic
986947806 5:13046231-13046253 TCCACAAGGGAGAAAAGGACAGG - Intergenic
987379412 5:17271070-17271092 GCCACAAGGGCGAAAATGACAGG - Intronic
987579459 5:19771180-19771202 TACACAAGGGTGTAAATGACAGG - Intronic
989044442 5:37260812-37260834 GACACTATGTTGAATAGGAGTGG + Intergenic
989064485 5:37445902-37445924 GACACTATGTTGAATAGGAGTGG - Intronic
989078278 5:37587994-37588016 GAAACCAGGATGAATAGAACAGG - Intronic
989244974 5:39244170-39244192 AACACTATGTTGAATAGGACTGG + Intronic
989502695 5:42187725-42187747 GACACAATAGTGAATACAACAGG + Intergenic
990071387 5:51787174-51787196 GACACTATGTTGAATAGGAGTGG + Intergenic
990881016 5:60539546-60539568 GACAAAAGGAGGAAGAGGACAGG - Intergenic
991154432 5:63414879-63414901 GATACAATGGTGAACAAGACAGG - Intergenic
994026561 5:95091110-95091132 GACACCAGGGTGAGTAGGTTTGG - Intronic
995061767 5:107818943-107818965 GAAGCAAAGGTGAATAAGACAGG + Intergenic
995413572 5:111884937-111884959 AACACTAGGTTGAATAGGAGTGG - Intronic
995422972 5:111988028-111988050 AACACTAGGTTGAATAGGAGTGG + Intronic
995690016 5:114815196-114815218 AACACTAGGTTGAATAGGAGTGG + Intergenic
996651380 5:125880838-125880860 GAAACAAGGATCAATAGCACTGG - Intergenic
999604562 5:153300256-153300278 GAAACAAAGGTGAATAGGAGAGG + Intergenic
1001262329 5:170241806-170241828 AACACTATGTTGAATAGGACTGG + Intronic
1001534015 5:172485965-172485987 GGCAGAAGGGTGAGTAGGATGGG + Intergenic
1001804259 5:174570036-174570058 GACCCCTGGGTGAATAAGACTGG + Intergenic
1004135294 6:12960477-12960499 GACAGAAGGGTCAATTGAACTGG + Intronic
1005002563 6:21257671-21257693 GACAGAAGGATGAATATGTCAGG - Intergenic
1005182499 6:23121988-23122010 AACACTAGGTTGAATAGGAGTGG + Intergenic
1007935407 6:45728044-45728066 GGCACAGATGTGAATAGGACAGG + Intergenic
1008329234 6:50225333-50225355 AACACTAGGTTGAATAGGAGTGG + Intergenic
1011255926 6:85420850-85420872 GAAACAAGAGTGAATATTACAGG - Intergenic
1012094941 6:94946107-94946129 AACACTATGGTGAATAGGAGTGG - Intergenic
1012147829 6:95708607-95708629 AACACTATGGTGAATAGGAGTGG - Intergenic
1012159440 6:95864950-95864972 AACACTATGGTGAATAGGAGTGG - Intergenic
1014565286 6:122941383-122941405 AACACTAGGTTGAATAGGAGTGG + Intergenic
1015636766 6:135283732-135283754 GAGACAAAGGGGAAAAGGACTGG + Exonic
1016005650 6:139086449-139086471 AACACTAGGTTGAATAGGAGTGG + Intergenic
1016111357 6:140229824-140229846 GACACAAGGGTAAATATTGCGGG + Intergenic
1016226942 6:141749988-141750010 AACACTATGGTGAATAGGAGTGG - Intergenic
1016265766 6:142231396-142231418 GACACTATGTTGAATAGGAGTGG + Intergenic
1017242075 6:152181492-152181514 GACAGAAGGGAGATTAGAACTGG - Intronic
1019106498 6:169671852-169671874 GACACAGTGGTGAATAGGAAGGG - Intronic
1020381183 7:7548358-7548380 GAGAGAAAGGGGAATAGGACTGG + Intergenic
1020640770 7:10751184-10751206 GACACTATGTTGAATAGGAGTGG - Intergenic
1020762966 7:12290431-12290453 GGCAGAAGGGTGAATAAGAGTGG + Intergenic
1022312563 7:29210911-29210933 GAGAAAGGGGTAAATAGGACTGG + Intronic
1022880324 7:34579887-34579909 GACACTATGTTGAATAGGAGTGG - Intergenic
1023964375 7:44955036-44955058 GCCACATGGGTGGATGGGACAGG - Intergenic
1024380362 7:48689040-48689062 AACACAAGGTTGAATAGGAGTGG - Intergenic
1025008658 7:55376806-55376828 GACACAAAGCTGAATAAGACTGG - Intronic
1025280573 7:57624101-57624123 GACACTAGGGTGATTCAGACAGG + Intergenic
1025304157 7:57841406-57841428 GACACTAGGGTGATTCAGACAGG - Intergenic
1028751000 7:94382884-94382906 GACACAGTAGTGAATAAGACAGG + Intergenic
1029322304 7:99774804-99774826 GACACTATGTTGAATAGGAGTGG - Intronic
1033653511 7:143359197-143359219 GACAGAAGGGTGAATAGGTCAGG + Intronic
1035639124 8:1169911-1169933 AACACTAGGTTGAATAGGAGTGG + Intergenic
1035858779 8:3005884-3005906 GACACTATGTTGAATAGGAGTGG - Intronic
1035885572 8:3287831-3287853 AACACTATGTTGAATAGGACTGG + Intronic
1036132992 8:6133634-6133656 GACACAAGGGTGGGAAGGTCTGG - Intergenic
1036537100 8:9660699-9660721 AACACTATGTTGAATAGGACTGG - Intronic
1036955452 8:13183344-13183366 AACACTAGGTTGAATAGGAGTGG + Intronic
1038141504 8:24850193-24850215 GATACAAAGGTCAATAGGAATGG - Intergenic
1039444457 8:37619810-37619832 GATACAAGGCTGATTAGAACTGG - Intergenic
1039718827 8:40140249-40140271 GACACTATGTTGAATAGGAATGG + Intergenic
1039854207 8:41398471-41398493 GACACAAGGGTCTATGGAACTGG + Intergenic
1042128701 8:65565180-65565202 AACACTATGGTGAATAGGAGTGG + Intergenic
1042135078 8:65625218-65625240 GATACTAGGCTGAATAGGAAGGG - Intronic
1042394882 8:68280395-68280417 AACACAAGGTTGAATAGGAGTGG - Intergenic
1043462480 8:80474350-80474372 AACACAATGTTGAATAGGAGTGG + Intergenic
1045429359 8:102098641-102098663 GAAACAAGGATGAATAAAACTGG + Intronic
1048342810 8:133553951-133553973 GACACAAGGGAGAAGAGTACAGG + Intronic
1049859346 8:144887670-144887692 GACACAAGGGAGCCCAGGACTGG + Intronic
1052117304 9:24664862-24664884 AACACTAGGTTGAATAGGAGTGG + Intergenic
1052705951 9:31993918-31993940 GACACTATGTTGAATAGGATTGG - Intergenic
1052814387 9:33089532-33089554 AACACTAGGTTGAATAGGAGTGG - Intergenic
1053439021 9:38099338-38099360 GACAAAAGGCTGAAATGGACTGG - Intergenic
1054794728 9:69289884-69289906 AACACTATGTTGAATAGGACTGG - Intergenic
1055545884 9:77372597-77372619 GACACTATGTTGAATAGGAGTGG - Intronic
1055861429 9:80754452-80754474 GACACATCAGTTAATAGGACAGG + Intergenic
1056867821 9:90245398-90245420 GAGACAAGGGTGCAGATGACAGG - Intergenic
1057768725 9:97947370-97947392 GACACTATGTTGAATAGGAGTGG + Intergenic
1058955342 9:109941710-109941732 GTCACAAGAGTCTATAGGACAGG + Intronic
1059306343 9:113356151-113356173 AACAGAAAGGGGAATAGGACGGG + Intronic
1060150652 9:121286177-121286199 GACCCATGGGTGAGTAGCACGGG + Intronic
1060915267 9:127385137-127385159 GCCTCCAGGGTGAGTAGGACTGG + Exonic
1062721409 9:138046182-138046204 GACACAGGGGTGACCAGAACAGG - Intronic
1203631943 Un_KI270750v1:78891-78913 GACACTAGGGTGATTCAGACAGG + Intergenic
1187259267 X:17670122-17670144 GACACAATGGTGAAAGGGATGGG + Intronic
1190687078 X:52884602-52884624 GACACTATGTTGAATAGGAGTGG + Intergenic
1190698904 X:52971190-52971212 GACACTATGTTGAATAGGAGTGG - Intronic
1191691119 X:63939382-63939404 AACACTATGTTGAATAGGACTGG - Intergenic
1192876589 X:75235910-75235932 AACACAATGTTGAATAGGAGTGG - Intergenic
1193376769 X:80770714-80770736 AACACTATGGTGAATAGGAGTGG - Intronic
1193839945 X:86397419-86397441 AACACTATGGTGAATAGGAGTGG + Intronic
1194713388 X:97262567-97262589 GACACAGGGGTGAGGATGACTGG + Intronic
1195855852 X:109331844-109331866 AACACTACGTTGAATAGGACTGG + Intergenic
1195913311 X:109911485-109911507 GCCTCAAGGATGAATAGGAAGGG + Intergenic
1196040582 X:111198667-111198689 GACACATAGATGAATAGGACAGG - Intronic
1197764028 X:130047814-130047836 GAGACAATGGTGAACAGGACAGG + Intronic
1199391155 X:147280808-147280830 GAGAGAAGGGTGAATTGGACAGG - Intergenic
1199391373 X:147283506-147283528 GAGAGAAGGGTGAATTGGACAGG - Intergenic
1199391591 X:147286205-147286227 GAGAGAAGGGTGAATTGGACAGG - Intergenic
1199483875 X:148327532-148327554 GACACCATGTTGAATAGGAGTGG + Intergenic
1200733697 Y:6771015-6771037 AACACTATGTTGAATAGGACTGG + Intergenic
1200737719 Y:6817973-6817995 AACACTATGTTGAATAGGACTGG - Intergenic
1200899139 Y:8410001-8410023 AACACAATGTTGAATAGGAGTGG + Intergenic
1201308611 Y:12573650-12573672 GACACTATGTTGAATAGGAGTGG - Intergenic
1201392794 Y:13516466-13516488 GACACTATGTTGAATAGGAGTGG + Intergenic
1201800342 Y:17948214-17948236 AACACTAGGTTGAATAGGAATGG - Intergenic
1201801211 Y:17957742-17957764 AACACTAGGTTGAATAGGAATGG + Intergenic
1202098559 Y:21280997-21281019 AACACTATGTTGAATAGGACTGG - Intergenic