ID: 913118131

View in Genome Browser
Species Human (GRCh38)
Location 1:115715140-115715162
Sequence ATCAAACAGAATCGGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913118131_913118137 30 Left 913118131 1:115715140-115715162 CCAGGGATCCGATTCTGTTTGAT 0: 1
1: 0
2: 0
3: 9
4: 57
Right 913118137 1:115715193-115715215 CCTTTGCTATTTGCTCCTCCAGG No data
913118131_913118133 -3 Left 913118131 1:115715140-115715162 CCAGGGATCCGATTCTGTTTGAT 0: 1
1: 0
2: 0
3: 9
4: 57
Right 913118133 1:115715160-115715182 GATTATAGCTTGTAAACCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 95
913118131_913118134 4 Left 913118131 1:115715140-115715162 CCAGGGATCCGATTCTGTTTGAT 0: 1
1: 0
2: 0
3: 9
4: 57
Right 913118134 1:115715167-115715189 GCTTGTAAACCTTAGGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913118131 Original CRISPR ATCAAACAGAATCGGATCCC TGG (reversed) Intronic
901606437 1:10462824-10462846 ATCAAACAGACTCTGGTCCAAGG - Intronic
903291512 1:22317242-22317264 TTCAGACAGACCCGGATCCCAGG - Intergenic
903423832 1:23238448-23238470 AACAAACAGAAGCGGATTGCAGG + Intergenic
906790236 1:48652856-48652878 ATCAATGAGAATAGAATCCCAGG - Intronic
906904243 1:49871463-49871485 ATATAACAGAATAGGATCACAGG - Intronic
908215684 1:61949323-61949345 ATCAAACCCAATCGCAACCCAGG - Intronic
909585712 1:77285319-77285341 AACAAACTGAATTGGATGCCCGG + Intronic
913118131 1:115715140-115715162 ATCAAACAGAATCGGATCCCTGG - Intronic
917265870 1:173220227-173220249 ATAAAACTGAATTGGATCTCAGG + Intergenic
919574736 1:199293857-199293879 ATCAAACAGAATCGGCTATTAGG + Intergenic
1064122972 10:12635243-12635265 ATCCAACACAACCGGATTCCGGG - Intronic
1065900852 10:30206673-30206695 GTGAAAGAGAATGGGATCCCAGG + Intergenic
1069017464 10:63446174-63446196 ATAAAACATATTCAGATCCCAGG - Intronic
1073581900 10:104676042-104676064 ATCACAAAGCATCAGATCCCTGG - Intronic
1078833615 11:15002604-15002626 ATCAAACAGAATTCATTCCCAGG - Intronic
1082226640 11:49715392-49715414 ATCAAGCAGGATTAGATCCCAGG - Intergenic
1086622787 11:88907688-88907710 ATCAAGCAGGATTAGATCCCAGG + Intronic
1089344624 11:117783137-117783159 ATCCAACAGAAACCGCTCCCAGG - Intronic
1092337089 12:7642685-7642707 ATCCAGCAGAACTGGATCCCGGG + Intergenic
1095121634 12:38425864-38425886 ATCAAACAATATCGCATCCCTGG - Intergenic
1099501425 12:83418857-83418879 TTCAAACAGCATGGGAACCCTGG - Intergenic
1100241283 12:92712626-92712648 ATAAAAAAAAATCGCATCCCTGG - Intergenic
1106407186 13:29484360-29484382 ATCAAATAGAAAGAGATCCCTGG + Intronic
1113912584 13:113850510-113850532 ATAAAACAGAAGCAGATCCCCGG - Intronic
1128417245 15:67458060-67458082 ATAAAACAGAATCAGTTCCTGGG - Intronic
1133440751 16:5819066-5819088 CTCAAACAGAATATGATACCAGG - Intergenic
1133637657 16:7684784-7684806 ACCAAACAGAATATGAGCCCAGG + Intronic
1134783585 16:16920872-16920894 ATCAAATAGAATAGAATCTCTGG + Intergenic
1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG + Intronic
926603206 2:14869293-14869315 ATCAACCACAAAAGGATCCCAGG + Intergenic
935173065 2:100625849-100625871 ATAAAACAGAATCTCTTCCCTGG + Intergenic
940239955 2:151551872-151551894 AGCAAAGAGAATGGGAACCCAGG + Intronic
942752651 2:179305449-179305471 ATGAAACAGAATCTGAACCCAGG + Intergenic
942900733 2:181114345-181114367 ATCAAAGAGAATTGAAACCCAGG - Intergenic
1170888554 20:20360709-20360731 ATCAAACAGAATCACACCCAAGG - Intergenic
1175505759 20:59483063-59483085 AGCACACAGACTCGGATCCCTGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
951360508 3:21719225-21719247 CTCAATCAGCATCAGATCCCAGG + Intronic
953199617 3:40767292-40767314 TTCAAACAGAAATGCATCCCAGG - Intergenic
955985742 3:64572583-64572605 ACTAAAGAGAATGGGATCCCTGG + Intronic
957945801 3:87060956-87060978 ATCACATAGAATCAGATGCCAGG - Intergenic
962617732 3:137144242-137144264 ATGAAACAGAATAGGAAGCCTGG - Intergenic
968455142 4:693914-693936 ATCAAACAGAAAGGAATCCCTGG - Intergenic
973535808 4:51880809-51880831 ATGAAACAAAATGGGATTCCAGG - Intronic
984224244 4:177015382-177015404 ATCAAACAAAATATGGTCCCAGG - Intergenic
990025670 5:51184709-51184731 GTCAAACAGAATGGGATCTTGGG - Intergenic
1000395890 5:160774362-160774384 ATGAAAGAGAATCAGAACCCTGG - Intronic
1004338009 6:14782214-14782236 ATCAAACAAAAACTGCTCCCTGG + Intergenic
1006076579 6:31536740-31536762 CTCAAACAGAGTGGGAACCCTGG - Intronic
1009564009 6:65287166-65287188 ATGAAACAGAATCAGAAACCAGG + Intronic
1012777444 6:103515902-103515924 ATCAAATAGAAAAGGATCCATGG - Intergenic
1014045046 6:116876106-116876128 AACAAACAAAATGGGATCCAAGG - Intergenic
1014778651 6:125538446-125538468 ATCCAACAGACTCGGGTTCCAGG + Intergenic
1020859678 7:13475563-13475585 ATCAAACAGCATCACATGCCAGG - Intergenic
1021957973 7:25845519-25845541 ATCAAACAGAAACTGACCCTGGG + Intergenic
1023557908 7:41442556-41442578 ATCACACAGCCTCTGATCCCAGG + Intergenic
1028121118 7:87058115-87058137 ATGAAAGAGAATCGGATCAAAGG - Intronic
1028342961 7:89745615-89745637 AGCCAACAAAATCGGCTCCCTGG - Intergenic
1029502766 7:100943853-100943875 ATCAAGCAGGATCAGACCCCTGG - Intergenic
1039391020 8:37180819-37180841 ATCAAACAGAATGGCAGCCCAGG + Intergenic
1043653876 8:82636212-82636234 ATCTAACAGAATATGAACCCAGG - Intergenic
1047366340 8:124215219-124215241 ATCAAAAAGAAACTGGTCCCTGG + Intergenic
1047552308 8:125888059-125888081 TTGAAACAGAATTGGAACCCAGG - Intergenic
1048053263 8:130839424-130839446 ATCAAACAGAATGAGGCCCCTGG + Intronic
1055953215 9:81749998-81750020 ATCATACAGAATCTGTTCCCTGG - Intergenic
1058170709 9:101677757-101677779 ATCAAACAGAATTGGACCACAGG - Intronic
1186526795 X:10256172-10256194 AATAAATAGAATCGGATCCCTGG - Intergenic