ID: 913120796

View in Genome Browser
Species Human (GRCh38)
Location 1:115738832-115738854
Sequence GTGCAAAGCCTCAATTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913120796_913120804 30 Left 913120796 1:115738832-115738854 CCTGTCTAATTGAGGCTTTGCAC No data
Right 913120804 1:115738885-115738907 CCCCCACCCCATCCTGCTTTTGG 0: 1
1: 0
2: 3
3: 73
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913120796 Original CRISPR GTGCAAAGCCTCAATTAGAC AGG (reversed) Intronic
No off target data available for this crispr