ID: 913120806

View in Genome Browser
Species Human (GRCh38)
Location 1:115738887-115738909
Sequence TGCCAAAAGCAGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913120806 Original CRISPR TGCCAAAAGCAGGATGGGGT GGG (reversed) Intronic
900206087 1:1432460-1432482 TGCTGAGAGCAGGGTGGGGTGGG - Intergenic
900539466 1:3195703-3195725 TGCCAGAAGCAGGAGGGAGAAGG + Intronic
900692414 1:3988555-3988577 GGCAAAAAGCAGGCTGAGGTTGG - Intergenic
901011470 1:6205098-6205120 TCCCAAAAGAGGGATGGGTTTGG - Intronic
901702023 1:11050163-11050185 GGTCAGGAGCAGGATGGGGTCGG + Intergenic
902078463 1:13805339-13805361 AACCCAAAGGAGGATGGGGTGGG - Intronic
903407934 1:23114401-23114423 GGCCGATGGCAGGATGGGGTGGG + Intronic
905302116 1:36992469-36992491 TGACAGAGGCTGGATGGGGTGGG + Intronic
906553841 1:46690890-46690912 TGCAAAGAGCAGGTGGGGGTGGG + Intronic
907318487 1:53587960-53587982 TCCCAAATGCATGGTGGGGTCGG - Intronic
907385533 1:54123048-54123070 GGCCAAAGGCTGGGTGGGGTTGG - Intergenic
907975080 1:59423713-59423735 TGCCAGAAGCTGGGTGGAGTGGG - Intronic
908929920 1:69306102-69306124 GGCCAGAAGCAGGATGGAGTGGG + Intergenic
911095794 1:94053971-94053993 AGCCAAAAGCAGGCAGGGGATGG - Intronic
911302678 1:96193742-96193764 TGCCAGAAGCAGGAAGAAGTGGG - Intergenic
911344600 1:96681349-96681371 TGCCATGATCAGGCTGGGGTTGG - Intergenic
912363578 1:109114350-109114372 TGACCAAAGCGGGATCGGGTAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913120806 1:115738887-115738909 TGCCAAAAGCAGGATGGGGTGGG - Intronic
915458937 1:156058196-156058218 TCCCAAGAGCAGGTGGGGGTTGG + Intronic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
916055847 1:161068620-161068642 TGCCAAAAACAAGCTGGGCTGGG + Intronic
916852097 1:168714012-168714034 TGCCAAAAGAAGGATGTGGGGGG + Intronic
917700248 1:177573441-177573463 TGGCCAAAGCAGGAGGAGGTAGG + Intergenic
923430009 1:233910920-233910942 TGCCAATAGCGGGCTGGAGTGGG - Intronic
923869061 1:237971227-237971249 TGCCAGAAACAGGATGGGAGAGG + Intergenic
924466443 1:244303101-244303123 TGACATAAGCAGGATGGAGAGGG + Intergenic
924778722 1:247128872-247128894 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778739 1:247128934-247128956 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778756 1:247128996-247129018 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778772 1:247129057-247129079 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778789 1:247129119-247129141 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778807 1:247129181-247129203 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778824 1:247129243-247129265 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778841 1:247129305-247129327 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778859 1:247129367-247129389 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778876 1:247129429-247129451 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778894 1:247129491-247129513 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778911 1:247129553-247129575 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778927 1:247129615-247129637 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778943 1:247129677-247129699 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778960 1:247129739-247129761 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778976 1:247129801-247129823 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778993 1:247129863-247129885 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924779009 1:247129925-247129947 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924779026 1:247129987-247130009 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924782931 1:247169546-247169568 TTCCCTGAGCAGGATGGGGTGGG - Intronic
1063039973 10:2327668-2327690 TGCCAAACGCAAGGTGAGGTAGG + Intergenic
1063385171 10:5611956-5611978 TGGCAACAGCAGTCTGGGGTTGG + Intergenic
1064065490 10:12177562-12177584 TGCCAAGAGGAGGTTGGGATGGG + Intronic
1064234531 10:13562054-13562076 TGCCAAAGGCAGGTTTGGCTTGG - Intergenic
1064314225 10:14239663-14239685 TGGCAAAAGCCAGGTGGGGTAGG + Intronic
1065385737 10:25131405-25131427 TGCCAAAAGTGGGGAGGGGTGGG + Intergenic
1065420249 10:25535475-25535497 TGACAACAGCAGCATGGGCTTGG + Intronic
1066024434 10:31340246-31340268 TACCAAAAGCAGGATATGCTTGG - Intronic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1069166026 10:65160257-65160279 TGCCAATGGCTGGAGGGGGTAGG + Intergenic
1070052565 10:72903577-72903599 AGAAGAAAGCAGGATGGGGTGGG - Intronic
1070238680 10:74656223-74656245 TGCCAAAGGCTGGAGTGGGTGGG - Intronic
1071571771 10:86701120-86701142 TGCTGGAGGCAGGATGGGGTGGG - Intronic
1074233580 10:111562099-111562121 GGGCAAAAGCAGGCTGGGGAAGG + Intergenic
1074514043 10:114148277-114148299 TGCCATTAGCAGGATGGGGCAGG - Intronic
1077107055 11:846724-846746 AGCCCAAGGCAGGGTGGGGTAGG + Intronic
1078144685 11:8714712-8714734 TGAGAAAAGCAGGATGGGTGAGG + Intronic
1078619063 11:12891273-12891295 TTTAAAAAGCAGGGTGGGGTGGG - Intronic
1080469075 11:32527729-32527751 TGCAAAAAGGAAGATGGTGTCGG - Intergenic
1081542097 11:44042744-44042766 TGGAAAGACCAGGATGGGGTTGG - Intergenic
1082177778 11:49081580-49081602 GGCAGAAAGCAGGCTGGGGTGGG + Intergenic
1083659448 11:64245463-64245485 TGCCCAAAGCGGGGTGGGGGGGG + Intronic
1085028369 11:73253890-73253912 TGCCAAAAGCAGCATGGATGCGG + Intergenic
1086045271 11:82524916-82524938 GGTCAACAGCAGGCTGGGGTGGG - Intergenic
1086346451 11:85902163-85902185 TGGCAGAAGCAGGTGGGGGTGGG + Intronic
1086687940 11:89754280-89754302 GGCAGAAAGCAGGCTGGGGTGGG - Intergenic
1086717909 11:90085614-90085636 GGCAGAAAGCAGGCTGGGGTGGG + Intergenic
1088257746 11:107916790-107916812 AGCCAGAAGGAGGATGGAGTGGG - Intronic
1089320917 11:117626201-117626223 TGCCAGAAGAAGGAGGGGGGGGG - Intronic
1089345879 11:117791477-117791499 TGCCAAAGGAAGGCTGGGGTTGG - Intronic
1089350756 11:117820379-117820401 AGACAAAGGCAGGATGGGGTTGG + Intronic
1089356118 11:117855086-117855108 GGACTAAAGCATGATGGGGTGGG + Intronic
1092110056 12:5953725-5953747 TGACAAAAGCTGGTTGGAGTTGG - Intronic
1092504760 12:9086100-9086122 TGCCAAAAGCTGGAAGAGGAAGG + Intronic
1093209765 12:16293902-16293924 AGGAAAAAGCAGGTTGGGGTCGG + Intergenic
1093416991 12:18931078-18931100 AGGCAAAAGTAGGATGGGTTGGG - Intergenic
1094029049 12:25989829-25989851 TGCTAAGAGCAGCATGGGATAGG + Intronic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094406471 12:30121532-30121554 AGCCAAAAGGGGGATGGAGTGGG - Intergenic
1094462654 12:30714103-30714125 TGCTAAATGCAAGGTGGGGTTGG + Intronic
1096263152 12:50105247-50105269 GGCCAAAAGCAGCCTGGGCTTGG - Intronic
1096804287 12:54130912-54130934 TCCCAAAAGTGGGATGGGGCAGG + Intergenic
1102015868 12:109647632-109647654 TGCCAGAAGCAGTGAGGGGTTGG + Intergenic
1103075744 12:117981186-117981208 TGGCAACATCAGGATGGGGGTGG + Intergenic
1103533618 12:121619849-121619871 TACAAAATGCAGAATGGGGTCGG - Intergenic
1103902493 12:124310607-124310629 TGTGAGGAGCAGGATGGGGTGGG + Intronic
1107763249 13:43704603-43704625 TGCAAAAAGCAACAGGGGGTGGG + Intronic
1107868507 13:44726661-44726683 GGTCAGAAGCAAGATGGGGTTGG - Intergenic
1109108196 13:58281589-58281611 TGACAAAAGCAGGTTCAGGTTGG + Intergenic
1109295889 13:60530318-60530340 TGAGAAAAGTAGGATGGTGTGGG + Intronic
1109421273 13:62115601-62115623 AACCAAAAGCAGGATGGAGTGGG - Intergenic
1111256581 13:85677411-85677433 AGCTAAAAGCAAGATGGAGTTGG + Intergenic
1111296756 13:86289443-86289465 TGCCAAAACAAGGATGGAGCTGG - Intergenic
1111521576 13:89412287-89412309 GGTTAAAAGCAAGATGGGGTTGG - Intergenic
1111529491 13:89518323-89518345 GGTTAAAAGCAAGATGGGGTCGG + Intergenic
1114797607 14:25734398-25734420 TGGAAAAAGCAGGATAGGCTGGG - Intergenic
1114814643 14:25943014-25943036 TGCCAGAAGAAGGATGAGCTGGG + Intergenic
1115118953 14:29916506-29916528 TGTCAAAAGCAGGAAAGAGTTGG - Intronic
1121439256 14:93938614-93938636 TGTCAAGAGCAGGCTGGTGTAGG - Intronic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1122482743 14:102058017-102058039 GGCTAGAAGCAAGATGGGGTCGG - Intergenic
1122742436 14:103880083-103880105 TGCCCAAAGCAGGAGGGGAAAGG - Intergenic
1127281734 15:57498848-57498870 AGCCAGTAGAAGGATGGGGTGGG + Intronic
1127295028 15:57601700-57601722 TGCCAAGAGGAGGATGAGGATGG + Intronic
1127818740 15:62636772-62636794 TGCTAAAAGCAGCATGGGTTTGG - Intronic
1128937221 15:71757133-71757155 TGCCAAAGGTAGGAGGGGCTGGG + Intronic
1129027314 15:72589415-72589437 TCCCAAAGGCAGGATGAGATTGG + Exonic
1130411260 15:83650568-83650590 TGCCAAAGGCATGGTGTGGTGGG - Intergenic
1130644219 15:85709495-85709517 TGACAGAAGCAAGCTGGGGTGGG - Intronic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131597312 15:93811586-93811608 AGCCAAAGGCAAAATGGGGTGGG + Intergenic
1131858651 15:96627380-96627402 TAACAAAAGCAGGAAGGGGGGGG - Intergenic
1132249967 15:100328615-100328637 TAACAAAATCAGGGTGGGGTGGG - Intronic
1132361346 15:101218652-101218674 TGCCAACAGAAGGCTGAGGTGGG + Intronic
1132787684 16:1667023-1667045 TGCCCCAAGGAGGGTGGGGTGGG + Intronic
1134409786 16:13994327-13994349 TGCCAAATGCAGGAATGGATAGG - Intergenic
1135955756 16:26955109-26955131 GGCTGAAAGCAGAATGGGGTCGG - Intergenic
1136108368 16:28047877-28047899 TGCCAAAAGCTGGATGAGGTAGG - Intronic
1136142205 16:28294735-28294757 TGCCAGCAGCAGGTGGGGGTGGG - Intronic
1137392452 16:48092740-48092762 TCCCAAAAGCAGGTTGATGTGGG + Intronic
1137484912 16:48882726-48882748 TGACCACAGCAGGATGGGGAGGG - Intergenic
1137486490 16:48895623-48895645 TGAGAAAGGCAGGATGGGGCAGG + Intergenic
1137905643 16:52319361-52319383 TCCCAAAAGAAGGAAGGGATGGG - Intergenic
1138382791 16:56615173-56615195 TGCCAAAGGCAGCATGGGCCTGG - Intergenic
1143165420 17:4895051-4895073 TGCCAGAAGGAGGAGGAGGTGGG - Intronic
1143478224 17:7215000-7215022 CCCCAAATGCTGGATGGGGTAGG - Intronic
1144339462 17:14300317-14300339 TGCCGAAAGTAGGTTGGGGAGGG - Intergenic
1146944893 17:36866871-36866893 TGCCATCAGCAGGCTGGGGCTGG - Intergenic
1148044974 17:44737991-44738013 TGCTAAAAGCAGGGTGGGGGTGG - Intronic
1148103035 17:45104313-45104335 TGCCTACAGCAGGCTGGGCTGGG - Intronic
1148151127 17:45396890-45396912 TGCGCAAGGCAGGATGGGGTGGG - Intronic
1149224509 17:54453772-54453794 TGCCTATGGCAGGATGGGGAAGG - Intergenic
1149850372 17:60030346-60030368 TGACCAAAGCAGGGTGGGGAGGG + Intergenic
1149859794 17:60116178-60116200 TGACCAAAGCAGGGTGGGGAGGG - Intergenic
1149999761 17:61426357-61426379 GGCCAAAAGCAGGTTGAGGTTGG + Intergenic
1151476811 17:74348823-74348845 TTCCAAAGGCAGGAAGGGGATGG + Intronic
1152141172 17:78537674-78537696 GGCCAAAAGCAGGCAGGGGCAGG + Intronic
1152667202 17:81577980-81578002 TGCTGACAGCCGGATGGGGTGGG - Intronic
1153159917 18:2192439-2192461 GGCAAAAAGCAAGATGGGGCTGG - Intergenic
1153351369 18:4084048-4084070 AGCCAGAAGCGGGATGGAGTGGG + Intronic
1155145598 18:23080885-23080907 TTCCAAAGGCAGGTTGAGGTGGG - Intergenic
1155493895 18:26424482-26424504 GGCCAAAGGCAGGAATGGGTGGG - Intergenic
1156193811 18:34750412-34750434 GGCCAAAAGAAGGATGGAGAAGG - Intronic
1156343324 18:36232649-36232671 TACCAAAAGCAGGGACGGGTAGG - Intronic
1156400000 18:36731576-36731598 TGCCAATAGGAGGATGGGTTAGG - Intronic
1157461515 18:47900496-47900518 TGATAAAAGGAGGATGGGGAGGG - Intronic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1158130814 18:54150594-54150616 TCCAAAGAGCAGGGTGGGGTGGG - Intergenic
1158692124 18:59670113-59670135 TTCAGAAAGCAGGAGGGGGTGGG + Intronic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1159894906 18:73987396-73987418 GGCTAAAAGCAAGATGGAGTTGG - Intergenic
1160717920 19:584804-584826 TGCCAACAGGACGATGGGGAAGG + Intergenic
1160787099 19:905729-905751 TGCCTGAAGCAGGAAGGGGACGG + Intronic
1161567705 19:5012748-5012770 GGCCATCAGCAGGATGGGGTTGG + Intronic
1161723975 19:5918020-5918042 TGCAGAAGGCAGGAGGGGGTAGG - Intronic
1161803032 19:6426254-6426276 TGGCAAAAGCAGGCTGGGGGTGG - Exonic
1164686028 19:30167394-30167416 TGCCCACTGCAGGGTGGGGTTGG + Intergenic
1164714167 19:30379495-30379517 CGCCATAAGGAGGATGGGGTGGG + Intronic
1164930823 19:32174544-32174566 TGCAGAAAGCAGGGTGGGCTGGG - Intergenic
1165079782 19:33300698-33300720 AGCCTATAGCAGGCTGGGGTGGG + Exonic
1168699223 19:58426174-58426196 TGCCAGAAGAAGGCTGGGGCTGG + Intergenic
925204207 2:1992627-1992649 TGTTAAAAGCAAGATGGAGTGGG - Intronic
925575974 2:5360393-5360415 GGTGAAAAGCAGGATGGAGTGGG - Intergenic
925695825 2:6577324-6577346 TGCTAAATGCAGGTTGGGGAAGG - Intergenic
926047502 2:9720546-9720568 TTACAAAAGCAGGTGGGGGTAGG + Intergenic
926267927 2:11343867-11343889 TGCCGGAAGCAGGGCGGGGTGGG + Intronic
928268836 2:29836094-29836116 TGCAGGAAGCAGGATGGGGAAGG - Intronic
930812128 2:55553614-55553636 TGCCAAGAGCTGGGTGGTGTGGG - Intronic
931118662 2:59192415-59192437 TACTAAAATCAGGAAGGGGTGGG + Intergenic
931757696 2:65388662-65388684 GACCAAAAGCAGGAGGGGGGTGG + Intronic
931764584 2:65443664-65443686 TTCTAAAGGCAGGAAGGGGTGGG - Intergenic
931925778 2:67071003-67071025 TGCAAAAAGCAGGGTGGAGGTGG + Intergenic
932046101 2:68351414-68351436 TTTCAAAAGCAGAATTGGGTAGG - Intergenic
932434896 2:71697441-71697463 TGCCCATAGTAGGCTGGGGTGGG + Intergenic
933141440 2:78795749-78795771 AGCCAGAAGGAGGATGGAGTGGG + Intergenic
934583601 2:95468137-95468159 TGCCAGAAGGGGGATGGAGTGGG + Intergenic
934595851 2:95608577-95608599 TGCCAGAAGGGGGATGGAGTGGG - Intergenic
934786923 2:97016911-97016933 TGCCAGAAGGGGGATGGAGTGGG + Intronic
934850617 2:97698256-97698278 TGCCAGATGCAGGATGGCCTGGG - Intergenic
934942025 2:98509658-98509680 TGCCAGGAGCAGCCTGGGGTGGG - Intronic
935568647 2:104635933-104635955 TAACAAAAGCAGGCTGGGGATGG - Intergenic
939018978 2:136936516-136936538 TGCCACAACCTGGATGGGATTGG + Intronic
939436213 2:142181049-142181071 GGCCAGAAGGAGGATGGAGTAGG - Intergenic
939451162 2:142376410-142376432 AGCCAAAAGGTGGATGGAGTGGG - Intergenic
939694143 2:145303156-145303178 CTCCAAAAGAAGGATCGGGTGGG - Intergenic
941740941 2:169034515-169034537 AGCCACAAGAAGGATGGGTTAGG + Intergenic
942403947 2:175633301-175633323 AGCCAACAGGAGAATGGGGTAGG + Intergenic
946210471 2:218143541-218143563 AGCCAGAAGGAGGATGGAGTGGG + Intergenic
946814211 2:223558980-223559002 TGCCAGAGGCTGGAGGGGGTGGG + Intergenic
948541400 2:238693707-238693729 GGCAAATAGCAGGATGTGGTAGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1168913732 20:1469584-1469606 TGCCAAAGGAAGGCTGGGGTGGG - Intronic
1169454609 20:5741233-5741255 TCCAGAAAGCAGGATTGGGTGGG - Intergenic
1169503118 20:6180558-6180580 TGGGAAAAGCAGGATGGAGTAGG - Intergenic
1170816760 20:19720640-19720662 TGCTTAAAGCAAGATGGGGAAGG + Intronic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171491189 20:25518747-25518769 ATCCAAAAGCAGGGTGGGGGAGG - Intronic
1172175771 20:32970991-32971013 TGCCATGGGCAGCATGGGGTGGG + Intergenic
1172587484 20:36094698-36094720 TGCCAAAAGCAGCAGAGGCTGGG + Intronic
1172789306 20:37491543-37491565 TGACAAAAGAAGGAGGGGATGGG - Intergenic
1173025644 20:39305257-39305279 TGAGAGAAGCAGGATGGGCTGGG + Intergenic
1173500182 20:43547602-43547624 TGCCAAAAGCAGAGGGGGGCAGG - Intronic
1174102730 20:48139556-48139578 TGCCAAATCCAAGATGGGGATGG - Intergenic
1174774895 20:53334480-53334502 TGGCTGAAGCAGGATGGGGGAGG + Intronic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1174937015 20:54881926-54881948 TGCCAACAGCAGGAGGAAGTGGG + Intergenic
1179641021 21:42747302-42747324 TGCAAAAGGCAGGGTGGGGGTGG + Intronic
1179937313 21:44613732-44613754 AGACAAAAGCATCATGGGGTGGG + Intronic
1182456387 22:30453706-30453728 TGCTAAAAGCAGGCTGGGCTGGG - Intronic
1182458209 22:30466052-30466074 TGCCAGAAGCAGTCTGGGGAGGG + Intronic
1182701080 22:32238916-32238938 TGCTAATTGCAGGTTGGGGTGGG + Intronic
1183969838 22:41468601-41468623 TGCCGCAAGCAGGCTGGTGTTGG - Exonic
949591595 3:5499985-5500007 TGTGAACAGCAGGATGGGGGAGG + Intergenic
949946738 3:9195560-9195582 TGGCAACAGAAGGATGGGGAGGG - Intronic
950615038 3:14151499-14151521 TGCCAGCAGCAGGCTGGAGTGGG - Intronic
951571284 3:24065866-24065888 TGCCAAAGGCAAGATGGGTATGG - Intergenic
952194637 3:31061952-31061974 TGTCAAAAGCAAAATGGAGTCGG - Intergenic
952865056 3:37849659-37849681 TGCTTAAAGCAGGATGGCGTAGG - Intergenic
953570609 3:44068405-44068427 GGACAACAGCAGGATGGGGCTGG + Intergenic
954043762 3:47911225-47911247 TGGCAAAAGCAGGAAGGGAAGGG - Intronic
954193795 3:48984029-48984051 AGCCCACAGCAGAATGGGGTTGG + Exonic
959133016 3:102381595-102381617 TGCCAACAGCGGATTGGGGTTGG + Intronic
959406458 3:105967167-105967189 TGACAGGAGCAGGATGGAGTGGG - Intergenic
959694988 3:109239736-109239758 TGCCAAAAGCAGGCCGGGTGTGG + Intergenic
960092260 3:113653144-113653166 TGCCAAAAATGGGATGGGGTGGG - Exonic
960152218 3:114261954-114261976 TGCCTGAGGCAGGATGGGGAAGG + Intergenic
960743071 3:120856191-120856213 AGCCAAAACTAGGATGGGGATGG - Intergenic
961105964 3:124241859-124241881 TGCTAAAAGCACGAAGGGGTAGG + Intronic
962194455 3:133348874-133348896 TTCCAAAAACAGGATTGGGAAGG + Intronic
962311117 3:134327519-134327541 TGCCAAAGGCTGGTTGAGGTGGG - Intergenic
962415894 3:135181673-135181695 TGACAAAAGCAGGTGGGGGTGGG - Intronic
962648745 3:137466734-137466756 GGCCAAAACCAAGGTGGGGTTGG + Intergenic
963940860 3:151094973-151094995 TGCCAAAAGCTGGATAGGGCTGG + Intronic
964499305 3:157330936-157330958 TTCCAACAAAAGGATGGGGTGGG - Intronic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
965661785 3:171049702-171049724 TGCTCACAGCAGGATGGGGATGG + Intergenic
966143477 3:176783899-176783921 GGCAAAGAGCAGTATGGGGTGGG - Intergenic
966621199 3:181966115-181966137 TGCCAAAAACAGTAAGAGGTGGG + Intergenic
966669896 3:182515295-182515317 TGCTAACAGGAGGATGGGCTTGG + Intergenic
966993173 3:185254585-185254607 AGCTAAAGGCAAGATGGGGTTGG - Intronic
967330891 3:188288218-188288240 TGCCGAAAGCAGGCTGTGATGGG + Intronic
967408291 3:189141500-189141522 TGCCAAGTGCAGGATGCTGTGGG + Intronic
969521058 4:7677968-7677990 TGCCAAGAACAGGGTGGGGTGGG + Intronic
969634624 4:8359763-8359785 TGCCTGAGGCAGGATGGGGAAGG - Intergenic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
970856710 4:20657660-20657682 TGCCACAACCTGGATGGAGTCGG + Intergenic
974581332 4:63806519-63806541 TGCCAAGATCAGGATTTGGTGGG + Intergenic
977036405 4:91958884-91958906 TGCCAAAAGCAAGGTGGGCGTGG + Intergenic
977305624 4:95319797-95319819 TGCCAAAAAAATGATAGGGTGGG + Intronic
978744900 4:112181867-112181889 TCCTAAAAGCAGGATGGAGGTGG + Intronic
979602782 4:122604504-122604526 TGAGAAAAGCAGGATAGGGAAGG - Intergenic
981163073 4:141522145-141522167 AGCCATTATCAGGATGGGGTGGG + Intergenic
981423798 4:144581077-144581099 AGCCAAAAGGGGGATGGAGTGGG - Intergenic
982258076 4:153468747-153468769 TGTCAAAATCAGGAGGGGGTGGG - Intronic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
984270457 4:177542882-177542904 TGGCAGAATTAGGATGGGGTGGG - Intergenic
985339484 4:188934098-188934120 GGCTAGAAGCAGGATGGAGTGGG - Intergenic
985540623 5:485837-485859 TTGCAAATGCAGGCTGGGGTGGG + Intronic
985547395 5:516550-516572 TGGCAACATCAGGATGGGGCTGG + Intronic
985631563 5:1016810-1016832 TGTGGAAAGGAGGATGGGGTAGG - Intronic
985631578 5:1016882-1016904 TGTGGAAAGGAGGATGGGGTCGG - Intronic
985667077 5:1186882-1186904 AGAGAAAAGCAGGAGGGGGTGGG - Intergenic
985835985 5:2272252-2272274 TGCCAGAAGGTGGCTGGGGTTGG + Intergenic
987323813 5:16794564-16794586 TGCCCTAAGGAGGCTGGGGTTGG + Intronic
989345458 5:40424614-40424636 TGCCAGAGACAGTATGGGGTGGG - Intergenic
990092770 5:52074405-52074427 TGCCAAAGGCAGAATGGTTTTGG - Intronic
990890852 5:60648326-60648348 TTCCAAAGGCAGGAAGGTGTGGG - Intronic
991004072 5:61810654-61810676 TGCCAAAAGGCGAAAGGGGTAGG + Intergenic
991190749 5:63870268-63870290 TGGCAAAGGAAGGATGGGGTAGG + Intergenic
991666969 5:69009131-69009153 TGCCAAAAGCTGAAGGGGGCAGG - Intergenic
992543305 5:77785401-77785423 GTCCAGAAGCAGGATGGCGTTGG - Intronic
992859374 5:80895640-80895662 TGTCAAATGCAGGGTGGGGTGGG - Intergenic
992904617 5:81334102-81334124 AGCCAGAAGGAGGATGGAGTGGG - Intronic
994661649 5:102661230-102661252 GGCCAGAAGCGGGATGGAGTGGG - Intergenic
995624708 5:114063719-114063741 TGCTAAAATCAGGATGGTCTGGG - Intergenic
997125859 5:131226108-131226130 TGCCAAAGACAGGATGGGTATGG + Intergenic
998046487 5:138991103-138991125 TGGCAATTGCAGGATGGTGTAGG - Intronic
999104469 5:149058652-149058674 GGAGGAAAGCAGGATGGGGTGGG + Intronic
999350626 5:150867288-150867310 TGCCACAACCTGGATGGAGTTGG - Intronic
1000516445 5:162241234-162241256 AGCCAGAAGCCGGATGGAGTGGG + Intergenic
1000658896 5:163915418-163915440 AGCCAGAAGGGGGATGGGGTGGG + Intergenic
1001082344 5:168676551-168676573 TGGTAAAAGCAGGAAGGGGAGGG + Intronic
1002021842 5:176368648-176368670 AGCTAGAAGCAGGGTGGGGTGGG + Intronic
1004474573 6:15959370-15959392 GGCAAAAGGCAAGATGGGGTTGG + Intergenic
1006403434 6:33830914-33830936 GGCCTACAGCAGGAGGGGGTCGG + Intergenic
1006624214 6:35385884-35385906 AGCCAAGAACAGAATGGGGTGGG + Intronic
1006731011 6:36236138-36236160 GGCCAGAAGGAGGATGGAGTGGG - Intergenic
1007545550 6:42690952-42690974 TGCCTAAATCAGGAAGGGTTGGG + Intronic
1007971776 6:46058974-46058996 TGCCAACAGCAGGAAGCTGTGGG + Intronic
1008016640 6:46527568-46527590 AGCCAAATACAGGATGGGGCTGG - Intergenic
1009911584 6:69936785-69936807 TGCCCAGAGCAGGATGGCTTTGG + Exonic
1010028377 6:71245749-71245771 AGCCAGAAGGAGGATGGGTTGGG + Intergenic
1010278861 6:74000926-74000948 GGGCAATAGCAGGATTGGGTTGG + Intergenic
1011906253 6:92372267-92372289 TGCGAAAAGAAGGATAAGGTTGG - Intergenic
1013870633 6:114755001-114755023 TCACAAAAACAGGATGGGGGAGG + Intergenic
1013917807 6:115363309-115363331 TGCCTAAAGCTGGCTGTGGTGGG - Intergenic
1013935588 6:115589332-115589354 TACCAGAAGCAAGATGGAGTTGG - Intergenic
1013946464 6:115728441-115728463 AGCCAAAAGGGGGATGGAGTGGG - Intergenic
1017272632 6:152526451-152526473 TGACAAGGGCAGGATGGTGTGGG + Intronic
1017971754 6:159317825-159317847 GGGCAAAAGCAGGATGGAGGAGG + Intergenic
1018431119 6:163723564-163723586 CGCAAAAGGCAGAATGGGGTTGG + Intergenic
1018653230 6:166008481-166008503 CGCCAAGGACAGGATGGGGTGGG + Intergenic
1019223790 6:170494884-170494906 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019223808 6:170494964-170494986 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019223833 6:170495083-170495105 GGCGAAAAGGAGGATGGGGTTGG + Intergenic
1019223867 6:170495242-170495264 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019223892 6:170495361-170495383 GGCGAAAAGGAGGATGGGGTTGG + Intergenic
1019223996 6:170495835-170495857 CGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224040 6:170496035-170496057 GGTAAAAAGGAGGATGGGGTTGG + Intergenic
1019224059 6:170496115-170496137 CGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224190 6:170496706-170496728 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224208 6:170496786-170496808 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1021083058 7:16386153-16386175 AGCTAAAAGAGGGATGGGGTGGG + Intronic
1021423347 7:20470538-20470560 TGCCCCAAGCTGGATGGGCTTGG - Intergenic
1021515821 7:21485428-21485450 TCTGGAAAGCAGGATGGGGTGGG - Intronic
1022191183 7:28018170-28018192 GGCCAAGGGCAGGATGGGGGTGG + Intronic
1024255623 7:47537977-47537999 TGCCAGGAGCAGGATGGCGGGGG - Intronic
1024440264 7:49408421-49408443 GGCCAGAAGGCGGATGGGGTGGG - Intergenic
1024617999 7:51132196-51132218 TGCCTAAAGCAGGGAGGGCTGGG - Intronic
1024903611 7:54351036-54351058 TTCCTAAAGCAGGATGCGGGAGG + Intergenic
1025008413 7:55374545-55374567 TGGGAAAAGCAGGCAGGGGTGGG - Intronic
1026024191 7:66732061-66732083 TGGCAGAAGCAGGCTGGGCTGGG - Intronic
1026888915 7:73970953-73970975 TGGCAGAAGCAGGCTGGGCTGGG - Intergenic
1026953845 7:74364519-74364541 TGTCAGCAGCTGGATGGGGTGGG + Intronic
1027828527 7:83148298-83148320 TTCCAAGAGAGGGATGGGGTTGG - Intronic
1031163383 7:118196580-118196602 TGCCAAAACCAAGAAGAGGTCGG - Intergenic
1031964561 7:128018338-128018360 TGTCAGCAGCTGGATGGGGTTGG - Intronic
1034228631 7:149501771-149501793 GGCCAGAAGGAGGATGGAGTGGG + Intergenic
1034560754 7:151877813-151877835 TGAAAAAAGCAGGGTGGGGTGGG - Intergenic
1035288220 7:157819636-157819658 TGCCAAAAGGAGGTAGGGGTGGG - Intronic
1036011575 8:4731246-4731268 AGACAAAAGCAGGTTGAGGTGGG - Intronic
1036039706 8:5062030-5062052 TGACAGAAGCAGGAAAGGGTAGG - Intergenic
1036446874 8:8829208-8829230 TGCCAGACTCAGGATGGGGAAGG - Intronic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1037886350 8:22598397-22598419 GGCCAAAGGCAGGGTGAGGTGGG + Intronic
1039442250 8:37603198-37603220 TGCCCAGAGCAGGATGAGGAGGG - Intergenic
1039836406 8:41259611-41259633 CTCCAAAAGGAGGAAGGGGTGGG + Intergenic
1042159219 8:65875112-65875134 ATCCAGAAGCAGGATGGAGTGGG + Intergenic
1042309286 8:67364362-67364384 TGCAACAGGCAGGATGGAGTTGG + Intergenic
1043487160 8:80709635-80709657 TGAGAAAGGCAGGATTGGGTGGG + Intronic
1045696113 8:104810547-104810569 TGGAAGAAGCAGGATAGGGTGGG + Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046960505 8:120107893-120107915 TGGCAAAATCAGTCTGGGGTAGG + Intronic
1048211513 8:132458034-132458056 TGCCATAAGGAGGATGTGGATGG - Intronic
1048279830 8:133097010-133097032 TGTCCAAGGCAGGGTGGGGTGGG - Intronic
1048671719 8:136730296-136730318 GGCCAGAAGCGGGATGGTGTGGG + Intergenic
1049394810 8:142395058-142395080 TGCCAGGAGCAGGAAGTGGTGGG - Intronic
1050629754 9:7545989-7546011 TGCAAAATGGAGGATGGGATTGG + Intergenic
1052857349 9:33415544-33415566 TGCTGAAAACAGGATGAGGTTGG - Intergenic
1055257399 9:74387574-74387596 ATCTAAAGGCAGGATGGGGTTGG - Intergenic
1056327353 9:85490909-85490931 AGCCAGAAGGAGGATGGAGTGGG - Intergenic
1058694337 9:107546724-107546746 TGCAAATAACAGGATGGAGTGGG - Intergenic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1060585334 9:124782081-124782103 TGCCAAGGGCAGGGTGGGCTGGG + Intronic
1186603994 X:11069981-11070003 TACCAATAACAGGGTGGGGTGGG + Intergenic
1186714177 X:12232624-12232646 TGGCAAAACCAGTATTGGGTGGG + Intronic
1187028040 X:15456403-15456425 TGAAAAAAGCAGGATTGGGCAGG + Intronic
1189110046 X:38279972-38279994 TGGAAACAGCAGTATGGGGTGGG + Intronic
1189427727 X:40916485-40916507 TGCCAAAAGGCTAATGGGGTAGG - Intergenic
1189737162 X:44083391-44083413 TGTCCCAAGCAGGATGGAGTGGG - Intergenic
1191104622 X:56764793-56764815 CGGCAACAGTAGGATGGGGTAGG + Intergenic
1192098517 X:68239077-68239099 AGCCAGAAGGAGGATGGAGTGGG + Intronic
1192157620 X:68758318-68758340 TGCAAAATTCAGGATGAGGTTGG + Intergenic
1192496493 X:71619787-71619809 GGCAAGAAGGAGGATGGGGTTGG + Intergenic
1192594622 X:72393671-72393693 TGGGAAAAGGAGGATGGGGAGGG + Intronic
1193900585 X:87171722-87171744 TGTCCAAGGCAGGATGGAGTAGG - Intergenic
1194040860 X:88940795-88940817 TGCCTGAGGCAGGATGGGGAAGG + Intergenic
1194126019 X:90017691-90017713 TGCCACAACCTGGATGGAGTTGG + Intergenic
1195382762 X:104286395-104286417 AGCCAAAAGGAGGCTGAGGTGGG + Intergenic
1196180274 X:112681920-112681942 TGGCAAATGAAGGATGGGGATGG - Intergenic
1196649049 X:118150196-118150218 GGCCAGAAGCAAGATGGAGTTGG - Intergenic
1197123108 X:122914425-122914447 AGCCTAAAGCTGGATGGGGCTGG + Intergenic
1198844816 X:140899669-140899691 TGCCTGAGGCAGGATGGGGAAGG + Intergenic
1200228275 X:154431385-154431407 CGCCAAAAGCAGGTGGGGGGAGG + Intronic