ID: 913126029

View in Genome Browser
Species Human (GRCh38)
Location 1:115791128-115791150
Sequence CAAGGCAACCAGAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913126024_913126029 11 Left 913126024 1:115791094-115791116 CCTGCTCTACTAATAGCAATGCA No data
Right 913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG No data
913126022_913126029 13 Left 913126022 1:115791092-115791114 CCCCTGCTCTACTAATAGCAATG No data
Right 913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG No data
913126023_913126029 12 Left 913126023 1:115791093-115791115 CCCTGCTCTACTAATAGCAATGC No data
Right 913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913126029 Original CRISPR CAAGGCAACCAGAAGGATGC TGG Intergenic
No off target data available for this crispr