ID: 913130620

View in Genome Browser
Species Human (GRCh38)
Location 1:115835223-115835245
Sequence GTGCCTGTCTTTCCCAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913130620_913130626 26 Left 913130620 1:115835223-115835245 CCTAAACTGGGAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 913130626 1:115835272-115835294 TGACTTCATACCCTTGGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 113
913130620_913130625 20 Left 913130620 1:115835223-115835245 CCTAAACTGGGAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 913130625 1:115835266-115835288 AGAAGTTGACTTCATACCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 123
913130620_913130623 -5 Left 913130620 1:115835223-115835245 CCTAAACTGGGAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 913130623 1:115835241-115835263 GGCACTTGGAAGGTTTCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913130620 Original CRISPR GTGCCTGTCTTTCCCAGTTT AGG (reversed) Intergenic
900608430 1:3534079-3534101 GTGCCTGACCTTCCCTGCTTGGG - Intronic
901095616 1:6676837-6676859 GTGCCTGTCTCTTCCAGTTCTGG - Intronic
902846418 1:19114070-19114092 GTCCCTGTCTTTTCCTGTCTAGG - Exonic
905868004 1:41386755-41386777 GTGCAGGCCTTACCCAGTTTGGG - Intergenic
907805472 1:57814893-57814915 GTGCTTGCCATTCCCATTTTAGG - Intronic
907872703 1:58457330-58457352 GTGCCTGTCTTTCCAGCCTTGGG - Intronic
908321773 1:62985552-62985574 ATTCCTGTCTTTCTCAGTTCAGG + Intergenic
908721430 1:67130336-67130358 GTGAATGAGTTTCCCAGTTTGGG + Intronic
909586335 1:77292763-77292785 GTGCTTGTCTTTCAAAGTTCAGG + Intronic
910030942 1:82722084-82722106 TTGCCTGCCTTTTACAGTTTTGG + Intergenic
911192126 1:94958645-94958667 GTGCCTTTCTTTACCAGGGTAGG - Intergenic
912233340 1:107821326-107821348 TTTACTGTCTTTCCCATTTTTGG - Intronic
913028704 1:114874179-114874201 TTGCCTGTCTCTCCAATTTTGGG + Intronic
913130620 1:115835223-115835245 GTGCCTGTCTTTCCCAGTTTAGG - Intergenic
913938364 1:125078538-125078560 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
913944471 1:125145518-125145540 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
913954709 1:143278257-143278279 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
913982728 1:143537108-143537130 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
918017023 1:180645220-180645242 GATCCATTCTTTCCCAGTTTGGG + Intronic
920560107 1:206932730-206932752 GTGCGTGCCTTTGCCAGTCTGGG - Intronic
921558198 1:216624602-216624624 CTGCCATTCTTTCTCAGTTTAGG + Intronic
921605232 1:217144511-217144533 CTGCCTGTCTCTCCAATTTTTGG - Intergenic
921835966 1:219779205-219779227 GTGGTTCTCTTTCTCAGTTTGGG - Intronic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
924291091 1:242537204-242537226 GAGACTGGGTTTCCCAGTTTAGG - Intergenic
1064640846 10:17414490-17414512 GTGCCTGTCTTAGTCAGCTTGGG + Intronic
1067734838 10:48842291-48842313 ATGCCTGTCTTTCTCTGCTTGGG - Intronic
1069643605 10:69974005-69974027 TTTCCTGTCTTTCCAAGATTTGG - Intergenic
1069728300 10:70595268-70595290 GTCTCTTTCTTTCCCAGTTCTGG - Intergenic
1071783520 10:88873953-88873975 GTGCCTGCCATTTCCAGTTTTGG + Intergenic
1073442760 10:103562440-103562462 GTGCCTGTCTTTCCCCCTGATGG - Intronic
1073576474 10:104630485-104630507 GTGACTGCATGTCCCAGTTTAGG - Intergenic
1073862610 10:107764810-107764832 CTGCCTGTTTTTTCCAATTTTGG + Intergenic
1073906926 10:108292712-108292734 GTGCCTGTCTTGGGCAGTTTTGG - Intergenic
1075132450 10:119751642-119751664 GTGCCTGTCATTCCAAGTGAGGG - Intronic
1075857252 10:125640266-125640288 GTGCCTGTATTACCCAATTTGGG + Intronic
1076295718 10:129382695-129382717 ATGCATGTCCTTCCCATTTTTGG - Intergenic
1077498010 11:2896063-2896085 CTGCCTGAGTTTCCCAGTTCTGG + Intronic
1083169819 11:60916752-60916774 GTGGCTGTCTGCCCCAGTTAAGG - Intronic
1083246896 11:61435779-61435801 GTTTCTGTCTTGCCCAGCTTGGG - Intronic
1083625166 11:64068691-64068713 GTGTCTGTCTCTCCCAGCTGAGG + Intronic
1084352332 11:68611292-68611314 GTCCAGGTCTATCCCAGTTTGGG + Intronic
1085159833 11:74329900-74329922 TTGCCTGCCTTTCCCAGATCAGG - Intergenic
1086088523 11:82981713-82981735 GTACTTGGCCTTCCCAGTTTTGG + Exonic
1089624290 11:119741491-119741513 GTCCCTGTCCTTCCCCGTGTGGG + Intergenic
1091906010 12:4189662-4189684 GTGCCTCTGTTTCCCATTCTGGG - Intergenic
1091962184 12:4705424-4705446 CTGCCTGTCTCTCCCATTTTGGG - Intronic
1095877599 12:47098883-47098905 GTCTCTCTCTTTCCCAGCTTTGG + Intronic
1096462197 12:51828193-51828215 GAGCCTGTCTTTCCCTGTGAAGG + Intergenic
1097718465 12:62994106-62994128 TTGCCTGTCTTTCCAATTTTAGG + Intergenic
1098551754 12:71770223-71770245 TTCCCTGTCTCTCCCAGTGTGGG + Intronic
1099281004 12:80646269-80646291 GTGCCTCAGTTTCCTAGTTTGGG - Intronic
1099439720 12:82686227-82686249 GTGTCTTTCTTTCCCTTTTTGGG + Intergenic
1099560590 12:84169349-84169371 TTGCCTGTAATTCCCAGTCTAGG + Intergenic
1100606129 12:96153447-96153469 TTGCCTGTCTTTCTCCGTTAGGG + Intergenic
1105233923 13:18527794-18527816 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1105899878 13:24745157-24745179 GCTCCTGACTTTCCCAGCTTCGG + Intergenic
1106524500 13:30528036-30528058 GTGCCTGCTTTTTCCAATTTAGG - Intronic
1107742207 13:43462968-43462990 GTGCCTCTCATTCTCTGTTTTGG + Intronic
1108218762 13:48211688-48211710 GTGCCTGTCTTTCACAGTGTTGG + Intergenic
1108930783 13:55815669-55815691 GTTCCTGTCTTTCCCCTTCTGGG - Intergenic
1111484421 13:88877841-88877863 GGGGCTGTATTTCACAGTTTAGG + Intergenic
1112975146 13:105308590-105308612 GTGCCTGTCTCTCCAGATTTTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117753974 14:58954714-58954736 TTGCCTGTCTCCCCCAGTTAGGG - Intergenic
1118841424 14:69515911-69515933 CTGCCTGTCTTTTCAATTTTGGG + Intronic
1118889878 14:69899911-69899933 CTGCCTGTCTGTCCAATTTTGGG + Intronic
1119007794 14:70947926-70947948 GTGTCTGTCTTACGCAGTTGTGG + Intronic
1121969062 14:98339717-98339739 CTCCCTGTCTTTTCCAGCTTTGG - Intergenic
1122927184 14:104910174-104910196 GTATGTGTCTTTCCCAGTTCTGG - Intergenic
1123948161 15:25248844-25248866 TTCCCTGTCTTTCCAAGGTTTGG + Intergenic
1127566105 15:60189948-60189970 GTGCCTGTCTTTACGTCTTTCGG + Intergenic
1127945502 15:63747125-63747147 GTGCCTGTGCTATCCAGTTTGGG + Intronic
1129733949 15:77949329-77949351 GTGTCTGGCTTTCCCAAGTTTGG + Intergenic
1130521793 15:84667470-84667492 GTGCCAGTCTGTGCCTGTTTTGG - Intergenic
1130925255 15:88380755-88380777 GTCCCTGTCTTTCCTATTTAAGG - Intergenic
1133976038 16:10600565-10600587 GTCCCTGTCTTTCTGGGTTTGGG - Intergenic
1136946303 16:34655427-34655449 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1136968577 16:34944748-34944770 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1137089041 16:36165271-36165293 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1137093573 16:36224520-36224542 ATGCCTGTCTTTCTGATTTTGGG + Intergenic
1137218463 16:46424057-46424079 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
1139073873 16:63419078-63419100 ATGTATTTCTTTCCCAGTTTTGG + Intergenic
1139200339 16:64969804-64969826 GTGCCTGAGTTTCCTTGTTTTGG + Intronic
1141593060 16:85081442-85081464 GTGGCTTTATTTCCCGGTTTCGG + Intronic
1143466261 17:7138777-7138799 CTGCCCTTCTTTGCCAGTTTTGG + Intergenic
1143493450 17:7296844-7296866 TTGCCTGCCTTCCCCAGTCTTGG - Intergenic
1144188889 17:12824918-12824940 GTGCTTGACTACCCCAGTTTAGG + Intronic
1146800645 17:35817358-35817380 GTGCATGTCTTTCCCCTTTTTGG + Intronic
1148818015 17:50344949-50344971 GTGCCTGGCTTCCCCAGCTGGGG + Intergenic
1149058741 17:52395638-52395660 GTGTCTGTCTTTCACAGGTCAGG - Intergenic
1150140139 17:62721154-62721176 CTGCCTGTCTTTCCAATTTTAGG + Intronic
1151262859 17:72930341-72930363 GAGCCTGTCTTTGCTAGTTATGG - Intronic
1152507605 17:80761003-80761025 TTGCCTGTCTTTTTCATTTTTGG + Intronic
1203184138 17_KI270729v1_random:96070-96092 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1154515618 18:15162081-15162103 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
1155257603 18:24012582-24012604 TTGGCTGTCTTTCTCAGTTGGGG + Intronic
1156553527 18:38042700-38042722 GTGCCTGCCTTTCCCACTCCGGG - Intergenic
1157687884 18:49657418-49657440 GTGCCTGGCTATCCCATTTATGG - Intergenic
1158613867 18:58968250-58968272 GTGCCTGTCTTTGTCTGCTTTGG + Intronic
1159724746 18:71942698-71942720 GAGCCTGTGTTTCCCAGTGAGGG - Intergenic
1160105826 18:75975214-75975236 GTCACTTTCTTTGCCAGTTTAGG - Intergenic
1160240910 18:77122270-77122292 ATGGCTGTCTTCTCCAGTTTTGG - Intronic
1162457147 19:10792230-10792252 GTGCTTGCCTCTCCCAGTTGGGG + Intronic
1165684237 19:37804669-37804691 GGGACTGTATTTCCCTGTTTTGG - Intronic
1168578690 19:57535336-57535358 TTTCCTGTCTTTCCCAGAGTTGG + Intronic
925057147 2:864324-864346 GTGGCTGCCATTCCCAGTTGAGG + Intergenic
926010536 2:9402613-9402635 ATGCCTCTATTTTCCAGTTTTGG - Intronic
926655791 2:15404256-15404278 GAGCCTGTCTTGCTTAGTTTAGG - Intronic
926887879 2:17614270-17614292 TTGCCTGTCATCCCCAGTTGGGG + Intronic
929767471 2:44859067-44859089 CTGTCTGTCTTTCCAATTTTGGG - Intergenic
930739523 2:54816154-54816176 TTGCCTGTTTTTCACACTTTTGG + Intronic
931266200 2:60662364-60662386 GTGCATGTCTCTCCCACTCTTGG - Intergenic
934332090 2:92078102-92078124 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
934939621 2:98491046-98491068 TTGTCTGTCTGACCCAGTTTGGG - Intronic
935280173 2:101510492-101510514 GTGTCTGTTTTTCCCCTTTTGGG - Intergenic
935448408 2:103181199-103181221 GTGTCTGTCTTGATCAGTTTGGG + Intergenic
935646972 2:105345559-105345581 TTGCCTGTCTTGCCCTGATTAGG + Exonic
937913227 2:127086256-127086278 GTGTCTGTGTGCCCCAGTTTGGG - Intronic
939369108 2:141275394-141275416 TTTCCTGACTTTTCCAGTTTAGG - Intronic
940664179 2:156587239-156587261 GTGCCTGTATTTCACAAGTTAGG - Intronic
945967704 2:216206694-216206716 GCCCCTGTCTTTGGCAGTTTGGG + Intergenic
948050777 2:234977762-234977784 GTGCGTGTCTTTCCCAGCGCAGG - Intronic
1168841685 20:913872-913894 CTGCCTGTCTGTCTCTGTTTAGG - Intronic
1170075126 20:12410743-12410765 GCCCCTGTCTTTGTCAGTTTAGG - Intergenic
1170163546 20:13340123-13340145 GTTCCTGTTTTTCCCTGTTGAGG - Intergenic
1172101129 20:32484267-32484289 GTGCCTGGCTTTCCCAGCCCGGG - Intronic
1172588280 20:36100223-36100245 GGGCCTGGCTTCCCCAGTGTGGG - Intronic
1173100877 20:40087304-40087326 GTGCCTTTCGTTCCCATTTGTGG - Intergenic
1173102781 20:40103098-40103120 TTTCCTGTTTCTCCCAGTTTTGG + Intergenic
1174407854 20:50313677-50313699 GCCACTGTCTTTCCCATTTTTGG + Intergenic
1174427493 20:50442759-50442781 ATGCCTGTCCTTCCCAGCTGAGG - Intergenic
1176777910 21:13156070-13156092 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1177694211 21:24551581-24551603 GTGCCTGTAATTCTCAGATTGGG - Intergenic
1177886822 21:26757315-26757337 GTCCCTATCTTTCTCAGTGTTGG + Intergenic
1177975521 21:27845077-27845099 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1180525687 22:16257496-16257518 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1180527270 22:16304236-16304258 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1184782522 22:46656319-46656341 GTGCCTGTCTCTTCCCTTTTGGG + Intronic
1203322683 22_KI270737v1_random:83417-83439 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
950223665 3:11216039-11216061 TTGCATGTAGTTCCCAGTTTGGG + Intronic
950633261 3:14298082-14298104 GAACCTCCCTTTCCCAGTTTAGG + Intergenic
951508689 3:23478266-23478288 TTGCCTGTCTTTTACAGTCTAGG - Intronic
951994821 3:28715227-28715249 GTCTCTCTCTTGCCCAGTTTTGG - Intergenic
954259105 3:49425912-49425934 GTGGCTGTCTTTCACAGTGGAGG - Exonic
955543321 3:60000993-60001015 GCGCCTGTCGTTCCCTGTTCTGG + Intronic
955769890 3:62376061-62376083 GTGCCTCTCTTTCCAAATGTTGG + Intergenic
955792619 3:62604279-62604301 CTGCCTGTCTCTCCAATTTTGGG + Intronic
957042162 3:75344000-75344022 GTGCTTGTCTTTCCCATTGGAGG - Intergenic
958952084 3:100427619-100427641 GTAGCTGTCATCCCCAGTTTGGG + Intronic
960124598 3:113984934-113984956 ATGCCTGTCTCTCCAAATTTGGG - Intronic
964408322 3:156373113-156373135 CTGCCTGTGTTTTCCAATTTAGG - Intronic
965370201 3:167852778-167852800 ACGTCTGTCTCTCCCAGTTTTGG + Intergenic
967232378 3:187352515-187352537 AAGCCTGTCCTTCCCAGTATTGG + Intergenic
968273626 3:197423590-197423612 CTGCCTCTCTTTCCTAGTTCTGG - Intergenic
969204826 4:5635643-5635665 TTGCCTGTCTTTCTGAGTATGGG - Intronic
969962791 4:10962619-10962641 CAGCTTTTCTTTCCCAGTTTTGG - Intergenic
970426552 4:15951186-15951208 GCTCATGTCTTTCCCAGATTTGG + Intergenic
971863566 4:32140102-32140124 GATCCATTCTTTCCCAGTTTGGG - Intergenic
976210977 4:82669471-82669493 CTGCCTGTCTGTCCAATTTTGGG - Intronic
977295100 4:95201187-95201209 GTGCCTGTCTTAGACAGTTTGGG - Intronic
979572842 4:122250667-122250689 TTGCCTGTCTTTCCCTATTTTGG + Intronic
979874315 4:125868229-125868251 GTGTCTGTCTCTGCCAGTTTTGG - Intergenic
987060884 5:14242879-14242901 GGGCCTGTGTTTCCCATTTCTGG - Intronic
987488239 5:18547043-18547065 GTGGTTGTCTGTTCCAGTTTGGG + Intergenic
987547285 5:19328133-19328155 GTCACTTTGTTTCCCAGTTTTGG - Intergenic
989376381 5:40766747-40766769 GTGCCTTTCCCTCCCAGTGTTGG - Intronic
989604444 5:43230482-43230504 AGGACTGTATTTCCCAGTTTTGG - Intronic
990183072 5:53184165-53184187 GTGTCCTTCTTTCCCAGTGTTGG + Intergenic
993297521 5:86161455-86161477 ATGCCTGTCTTAGTCAGTTTGGG + Intergenic
993781253 5:92067559-92067581 TTGCCTGTCTCTCCAATTTTGGG + Intergenic
994561583 5:101380660-101380682 GTGTGTGTCTTTGCCATTTTTGG + Intergenic
994717976 5:103346713-103346735 TTGTCTGTCTTTCCAATTTTTGG + Intergenic
994915352 5:105969431-105969453 GTGCCTGTTTTTCCAATTTTGGG + Intergenic
995051460 5:107710584-107710606 TTGCCCGTCTCTCCCAGTGTGGG - Intergenic
996525504 5:124474901-124474923 TTACCTGTTTTTTCCAGTTTTGG + Intergenic
997043556 5:130286412-130286434 GTGCCCCTCTCTCTCAGTTTCGG - Intergenic
999356996 5:150944698-150944720 GAGCTTGTCTTACTCAGTTTGGG - Intergenic
1008449209 6:51630629-51630651 GTGCCTGTCATTTTCAATTTGGG - Intronic
1009169587 6:60381996-60382018 GGGACTGTCTTTCCCTGTTCTGG - Intergenic
1010523189 6:76867076-76867098 GTGGCTGTTTTTACAAGTTTTGG - Intergenic
1010735085 6:79435319-79435341 GCACCTGTCTTAGCCAGTTTAGG + Intergenic
1011911621 6:92448051-92448073 GTGGTTGTTTTTCCCACTTTTGG - Intergenic
1019287249 7:229906-229928 GTGTCTGTCTTATCTAGTTTTGG + Intronic
1019424421 7:967464-967486 TTTCCTGTCTTTCCCACCTTTGG + Exonic
1020360276 7:7320321-7320343 GGGCCAGTCTTCCCCAGTTTGGG + Intergenic
1020520547 7:9180572-9180594 GGGCCTCTATCTCCCAGTTTCGG - Intergenic
1021382845 7:19989100-19989122 TTGCCTGTCTCTCCAATTTTGGG + Intergenic
1023021505 7:36015561-36015583 GTCCCTGTATATCCCAGATTTGG - Intergenic
1024271741 7:47647672-47647694 CTGCCTTTCTTTCCTGGTTTAGG + Intergenic
1025231258 7:57204592-57204614 GTGCCTCCCTTTCTCTGTTTTGG - Intergenic
1025260597 7:57415140-57415162 GGGCCTGGCTTCCCCAGCTTAGG - Intergenic
1025321870 7:58103121-58103143 ATGCCTGTCTTTCTGATTTTGGG + Intergenic
1025475016 7:60908403-60908425 ATGCCTGTCTTTCTGATTTTGGG + Intergenic
1025487883 7:61074587-61074609 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
1025511985 7:61581470-61581492 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
1025556542 7:62316502-62316524 ATGCCTGTCTTTCTGATTTTTGG - Intergenic
1025563385 7:62399767-62399789 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1025566104 7:62435884-62435906 ATGCCTGTCTTTCTGATTTTCGG + Intergenic
1026561992 7:71458057-71458079 GTGGCTGTCTTTGACAGTGTGGG - Intronic
1027724946 7:81792377-81792399 GTGTCTGTCTCTCTCACTTTAGG + Intergenic
1027759289 7:82257509-82257531 GTGCCTGTAATTCACACTTTAGG - Intronic
1028282773 7:88952753-88952775 CTGTTTGTCTTTCCCAGCTTAGG + Intronic
1031656196 7:124359382-124359404 GTGCTTGTCTTGCTCAGTTTGGG + Intergenic
1035683193 8:1503852-1503874 GTGCCTGGCTTTCCCCTCTTGGG + Intronic
1035821151 8:2593449-2593471 ATGCATGTCTTTCTCAGGTTGGG - Intergenic
1037393592 8:18419615-18419637 TTGCCTCTCTTTCCAAGTTAAGG - Intergenic
1038723145 8:30056070-30056092 GGGACTGTCTTTCCCTGTTAAGG + Intergenic
1040817058 8:51519897-51519919 GTGCCTGTCTTTTCAGATTTAGG - Intronic
1041720011 8:60967296-60967318 GTGTATGTCTTACACAGTTTGGG - Intergenic
1043226419 8:77736481-77736503 ATGCCTGTTTTCCCCAGCTTAGG + Intergenic
1046154885 8:110275114-110275136 TTGACTGTGTTTCCCAGTTTTGG - Intergenic
1047257118 8:123222451-123222473 GTGCCTATCTGTCCCTCTTTTGG - Intronic
1047552964 8:125896669-125896691 CTGCATGACTTTGCCAGTTTAGG - Intergenic
1049000651 8:139823712-139823734 GTGCCAGTCTTTCCAGGTATGGG + Intronic
1049544910 8:143226054-143226076 GTGCCTGTGTTTACCAGCCTGGG - Intergenic
1050091789 9:2022766-2022788 ATGCCTGTCTCTCCTAGGTTAGG - Intronic
1050240433 9:3628885-3628907 GTCCCTGTCTTGCCCAATGTGGG + Intergenic
1053946604 9:43315523-43315545 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1057112678 9:92488673-92488695 GTGAATGTAATTCCCAGTTTAGG + Intronic
1057861890 9:98647222-98647244 GGGCCTGTCATTCCCAGTGATGG - Intronic
1059251835 9:112892697-112892719 GTCAGTGTCTCTCCCAGTTTAGG + Intergenic
1060013667 9:120067350-120067372 GCCCAAGTCTTTCCCAGTTTGGG + Intergenic
1060817019 9:126640365-126640387 GTGACTGTCCTACCCAGTCTGGG + Intronic
1061958329 9:133975169-133975191 GTGCCTGCCTTTCCTAGTAAGGG - Intronic
1062077266 9:134597504-134597526 GTGTCTGTCTTCACCGGTTTAGG + Intergenic
1062224665 9:135442981-135443003 GTGCATTTGTATCCCAGTTTTGG + Intergenic
1062646270 9:137550124-137550146 ATGCCTGGATTTCCCAGTTGGGG - Intronic
1203589734 Un_KI270747v1:44081-44103 ATGCCTGTCTTTCTGATTTTTGG + Intergenic
1186995055 X:15112038-15112060 TTTACTGTCTTTCCCAGTGTGGG + Intergenic
1187237654 X:17483526-17483548 GTGGCTCTCTTGACCAGTTTAGG + Intronic
1189501267 X:41561341-41561363 TTGCCTGTCTTTAGCAGTGTGGG - Intronic
1190070263 X:47273614-47273636 GTGGCTGTCTTTCACAGTGGAGG - Intergenic
1191254733 X:58274811-58274833 GTGCGTGTCTTTCCCACCTAAGG - Intergenic
1191799316 X:65059473-65059495 GAGACTGTCTTACCCAGTGTAGG + Intergenic
1192231290 X:69266895-69266917 ATGGCTGTCTTTGTCAGTTTGGG - Intergenic
1196276253 X:113768771-113768793 GTGCCATGCTTTCCCATTTTAGG + Intergenic
1196419057 X:115504347-115504369 TTGCCTGTCTCTCCAAGTTCAGG + Intergenic
1196666848 X:118326120-118326142 GAGTCTGTCTGACCCAGTTTGGG + Intergenic
1198152132 X:133921874-133921896 GTGCCTGTCTCTCCTGGTTAGGG + Intronic
1198156828 X:133968892-133968914 GTGCCTGACTTTGCCAGACTTGG - Intronic
1199970576 X:152857368-152857390 GTGCAAGTCTGTCCCACTTTTGG - Intronic