ID: 913133724

View in Genome Browser
Species Human (GRCh38)
Location 1:115866604-115866626
Sequence CAATGTATACACAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913133724_913133729 25 Left 913133724 1:115866604-115866626 CCTTCCAATTTGTGTATACATTG No data
Right 913133729 1:115866652-115866674 ACTGTAGTGTATATGTTGCGGGG No data
913133724_913133728 24 Left 913133724 1:115866604-115866626 CCTTCCAATTTGTGTATACATTG No data
Right 913133728 1:115866651-115866673 TACTGTAGTGTATATGTTGCGGG No data
913133724_913133731 30 Left 913133724 1:115866604-115866626 CCTTCCAATTTGTGTATACATTG No data
Right 913133731 1:115866657-115866679 AGTGTATATGTTGCGGGGGTAGG No data
913133724_913133727 23 Left 913133724 1:115866604-115866626 CCTTCCAATTTGTGTATACATTG No data
Right 913133727 1:115866650-115866672 TTACTGTAGTGTATATGTTGCGG No data
913133724_913133730 26 Left 913133724 1:115866604-115866626 CCTTCCAATTTGTGTATACATTG No data
Right 913133730 1:115866653-115866675 CTGTAGTGTATATGTTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913133724 Original CRISPR CAATGTATACACAAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr