ID: 913133864

View in Genome Browser
Species Human (GRCh38)
Location 1:115868210-115868232
Sequence GATTACTTACAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913133864_913133866 -5 Left 913133864 1:115868210-115868232 CCATCCACTTTCTGTAAGTAATC No data
Right 913133866 1:115868228-115868250 TAATCAGTCCCGATAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913133864 Original CRISPR GATTACTTACAGAAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr