ID: 913135900

View in Genome Browser
Species Human (GRCh38)
Location 1:115888835-115888857
Sequence GTGTAGAATGGGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913135900_913135911 30 Left 913135900 1:115888835-115888857 CCTGCAGTCTTCCCATTCTACAC No data
Right 913135911 1:115888888-115888910 TCACCTCCTCTCTCCAGCCTGGG No data
913135900_913135910 29 Left 913135900 1:115888835-115888857 CCTGCAGTCTTCCCATTCTACAC No data
Right 913135910 1:115888887-115888909 ATCACCTCCTCTCTCCAGCCTGG No data
913135900_913135903 -10 Left 913135900 1:115888835-115888857 CCTGCAGTCTTCCCATTCTACAC No data
Right 913135903 1:115888848-115888870 CATTCTACACCTCCAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913135900 Original CRISPR GTGTAGAATGGGAAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr