ID: 913150119

View in Genome Browser
Species Human (GRCh38)
Location 1:116033443-116033465
Sequence GCTGGTGGTGAGAGAGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913150119_913150126 10 Left 913150119 1:116033443-116033465 CCCCGTTCTCTCTCACCACCAGC 0: 1
1: 0
2: 2
3: 24
4: 351
Right 913150126 1:116033476-116033498 ATTCCACTATTGTCCTGAACTGG 0: 1
1: 0
2: 0
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913150119 Original CRISPR GCTGGTGGTGAGAGAGAACG GGG (reversed) Intronic
900926326 1:5708546-5708568 GCTGGACGTGAGAGAGAGAGTGG + Intergenic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
902983264 1:20140242-20140264 GCTGGGAGTGGGAGAGAAGGAGG - Intronic
903473836 1:23605975-23605997 GCTGGTGTTGGGAGAAAAGGCGG - Intronic
904834177 1:33324333-33324355 GCAGGTGGAGAGAGAGAAGCTGG - Exonic
904875788 1:33653581-33653603 GCAGGTGGGGAGGGAGAAAGTGG + Intronic
906077511 1:43062964-43062986 GCTGGTGGGGAGTGGGAAGGGGG + Intergenic
906708653 1:47913213-47913235 GAAGGTGGTGAGAGTGAACCTGG - Intronic
906727307 1:48053557-48053579 TCTGGTGGCCAGAGAGAACTAGG - Intergenic
906760338 1:48371839-48371861 GGTGGTGGCAAGAGAGAATGAGG + Intronic
907379129 1:54071026-54071048 GGTGGAGGTGGGAGAGAACATGG + Intronic
907861282 1:58356094-58356116 GGTGGAGATGAGAGAGAACCAGG + Intronic
909460091 1:75901791-75901813 GCTGGTGAGGATAGAGAAAGGGG - Intronic
910455948 1:87397425-87397447 CCTGGGGCTGAGAGAGACCGAGG + Intergenic
912812297 1:112803424-112803446 GAGGGTGGTGAGAGTGAAAGGGG - Intergenic
913150119 1:116033443-116033465 GCTGGTGGTGAGAGAGAACGGGG - Intronic
914681039 1:149938525-149938547 GATGGTGGTGAGAAGGAAAGTGG - Exonic
915310536 1:155003966-155003988 GCTGGTGTTTAGAGAGAGGGCGG + Intronic
915467004 1:156103852-156103874 GCTGGTGGAGCCAGAGAAGGGGG - Intronic
916730686 1:167564087-167564109 GCTGGAGGTGAGTGAGAAGTTGG + Intergenic
917218498 1:172702651-172702673 GTGGGTTGTGAGAGAGAAAGAGG + Intergenic
919350900 1:196452761-196452783 GCTGATGGTGTGAGAGACCCAGG + Intronic
923403113 1:233634575-233634597 GCTGTTGGAGAGAGTCAACGAGG + Intronic
924816168 1:247443875-247443897 GCAGCTGCTGAGAGAGGACGAGG + Intronic
1063573333 10:7237581-7237603 GCTAGGGGTGGGAGAGAATGGGG + Intronic
1065655459 10:27944236-27944258 GCGGGTGGTGAGGCAGCACGGGG - Exonic
1068775190 10:60861349-60861371 GCTTGGGGTGAGGGAGAAGGTGG + Intergenic
1070282275 10:75058548-75058570 GCTGGTTATGAGAGAGAAGCAGG + Intergenic
1070555535 10:77524933-77524955 GCTGGTGCTGAGGGAGGCCGGGG - Intronic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1070957049 10:80471076-80471098 GCTGGAGGGCAGAGAGAAGGAGG - Intronic
1071334025 10:84587084-84587106 GCTGGAGCTGAGAGAGACTGGGG - Intergenic
1072160763 10:92764224-92764246 GCTGGGGGTGAGCGGGAATGGGG - Intergenic
1074586946 10:114777035-114777057 GAGGGTGGGGATAGAGAACGGGG - Intergenic
1074715618 10:116215874-116215896 GCTGGTGGGGAGAGGGAGCCGGG - Intronic
1075028634 10:119005461-119005483 GTTGGTGGTGATAGAGGAGGTGG - Intergenic
1075415564 10:122259951-122259973 GGTGGTGGGGAGAGAAAAAGGGG - Intergenic
1075562844 10:123480863-123480885 GATGGTAGTGGGAGAGAGCGCGG + Intergenic
1075707678 10:124511560-124511582 GGTGGTGCTGAGAGAGAGCTCGG - Intronic
1076384611 10:130047362-130047384 GCTGGGGCTGAGAGAGAGCGAGG - Intergenic
1078772915 11:14367287-14367309 GCTGGAGGTGGAAGAGAATGGGG - Intergenic
1079202833 11:18390030-18390052 GCTTGAGGTGAGAGAGTACATGG + Intergenic
1079320339 11:19446749-19446771 CCTGGTGGGGAGGGAGAACCAGG + Intronic
1080183476 11:29451466-29451488 GAAGGTGTTGAGAGAGAAGGAGG + Intergenic
1080882857 11:36339007-36339029 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1080901802 11:36500653-36500675 GCTGGTGGTGAGTCACAACAGGG + Intronic
1083688507 11:64392135-64392157 GCTTGTGGGGAGAGAGCAAGGGG - Intergenic
1083716826 11:64582309-64582331 GCTGGTGGTGACTGAGATGGTGG - Intergenic
1083716830 11:64582333-64582355 GCTGGTGGTGACTGAGATGGTGG - Intergenic
1084064276 11:66694327-66694349 GATGGCTGTGAGAGAGAAGGAGG - Exonic
1084072299 11:66744526-66744548 GCTGGAGGTGAGCGGGAATGAGG - Intronic
1084405050 11:68967040-68967062 GCTGATGGAGAGAGAGAAACAGG + Intergenic
1084466724 11:69327675-69327697 GATGGTGGTGAGGGAGGAGGAGG + Intronic
1085507030 11:77066674-77066696 GCTGGGAAGGAGAGAGAACGAGG + Intergenic
1087664868 11:101032498-101032520 CCTGATGGGGAGAGAGAATGTGG - Exonic
1088754542 11:112874970-112874992 ACTGATGGTGAGAGAGACCATGG - Intergenic
1088946023 11:114513174-114513196 GCTGGAGGTGAGAGACCACTTGG - Intergenic
1089057011 11:115593844-115593866 GCGGGTGGGGAGAGACAACATGG + Intergenic
1089282148 11:117381939-117381961 GCTAGTGCTGAGAGAGATGGGGG + Intronic
1089306469 11:117529566-117529588 GGGGGTGGGGAGAGATAACGAGG - Intronic
1089973096 11:122710334-122710356 GCTGGTGGTTGGAGAGATGGTGG + Intronic
1090659713 11:128872983-128873005 GATGGTGGTGAGAGAGTGTGGGG - Intergenic
1091175765 11:133556312-133556334 ACTGGTGGAGAGAGAGAGAGAGG - Intergenic
1091698469 12:2643801-2643823 GCTGGTGCAGAGAGAGAGCTGGG - Intronic
1092088619 12:5786037-5786059 GCTGGGGGTGAGAGAAATCCAGG + Intronic
1092170093 12:6369150-6369172 GTTGGTGATGAGAGAGAGGGAGG - Intronic
1092745152 12:11666158-11666180 GCTAGTAGGGAGAGAGAACCCGG + Intronic
1093489987 12:19694767-19694789 GCTTGTGGTGAAAGAGAACCTGG + Intronic
1093538082 12:20247205-20247227 GCTGCTGGGGAAAGAGAAAGGGG - Intergenic
1095317634 12:40785377-40785399 GAAGGGGGTGAGAGAGAAGGGGG + Intronic
1095507372 12:42911691-42911713 GTTTGTGGTGGGAGAGAAGGAGG + Intergenic
1096070292 12:48771672-48771694 GCTGGTGGTGGCAGAGAGTGGGG - Intronic
1096555846 12:52403230-52403252 GTTGGGGGTGAGAGAAAAGGTGG + Intronic
1096846742 12:54411707-54411729 GCTGGTGCTGAGAGGTCACGTGG + Intronic
1098226039 12:68325963-68325985 GCTGGGGGTGAAAGGGAACAAGG - Intronic
1101221173 12:102642326-102642348 GCTGGTTGTTAAAGAGAACCTGG + Intergenic
1102601924 12:114037726-114037748 GGTGGAGGTGGGAGAGAAGGGGG + Intergenic
1104814084 12:131636150-131636172 GCTGGTGTGGACAGAGAACTAGG + Intergenic
1105021831 12:132821933-132821955 CCTGGTGTTGAGGGAGGACGTGG - Intronic
1106106347 13:26736712-26736734 GCTGGTGGTTAGAGGGGACATGG + Intergenic
1106321353 13:28642401-28642423 GCTGTTTGAGAGAGAGAAGGAGG + Intergenic
1107300551 13:38961529-38961551 GGTGGTGGTGATGGAGGACGTGG - Intergenic
1107971200 13:45644368-45644390 GTTGGTGGTGAGAGAAAAGAGGG + Intergenic
1108504234 13:51096288-51096310 GATGGTGGTGAGAGACAAGAGGG + Intergenic
1109475526 13:62876328-62876350 GGTGGTGGCGAGAGAAAATGAGG + Intergenic
1110303173 13:73953001-73953023 GCTGGTGGTAAGAAAGAGCTGGG + Intronic
1111983443 13:95040946-95040968 CCTGGTAGTGTGAGTGAACGAGG - Intronic
1112271970 13:97976671-97976693 GCTAGGCGTGAGAGAGAAGGAGG - Exonic
1112552562 13:100435272-100435294 AATGAGGGTGAGAGAGAACGGGG + Intronic
1112678613 13:101735080-101735102 GCTGGAGGAGAGAGAGAGTGGGG + Intronic
1112887750 13:104194479-104194501 GGTGGTGGTAAGAGAAAATGAGG - Intergenic
1114615740 14:24067430-24067452 CCTGGTGGTGGGAGTGAAAGAGG - Intronic
1115962695 14:38853438-38853460 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1117063134 14:51983065-51983087 GCTGGTGGAGAGTGAGAAGCTGG - Intergenic
1118620612 14:67611024-67611046 CCTGATGGTGAGTGTGAACGAGG + Intergenic
1119666545 14:76489133-76489155 GGTGGTGGAGAGAGAGGATGAGG - Intronic
1119683008 14:76606848-76606870 GCTGGGGGAGAGAGAGAGAGCGG + Intergenic
1119762886 14:77165156-77165178 GGTGGTGGTGATAGTGAAGGGGG - Intronic
1120733357 14:88027054-88027076 GCTGATGGTGAGGGAGGAAGTGG + Intergenic
1121406561 14:93722579-93722601 GCTGGTGGTGATAGTGATGGTGG + Intronic
1122824528 14:104363168-104363190 GCTGGTGGGAAGAAGGAACGAGG - Intergenic
1123430544 15:20211860-20211882 GATGGTGGTGATAGAGATGGAGG - Intergenic
1123450583 15:20357142-20357164 GCTGGTCCTAAGAGGGAACGGGG + Intergenic
1124430168 15:29600424-29600446 GATGATGGTGGGAGAGAACTGGG - Intergenic
1125266922 15:37892282-37892304 GCTAGTGGAGAGAGAGGAAGAGG - Intergenic
1127913981 15:63440462-63440484 GCTGGTGGTGGGTGGGAAGGTGG - Intergenic
1128896585 15:71379225-71379247 GCTGTTGGTTACAGAGAACAAGG + Intronic
1128991480 15:72264367-72264389 GCTTGTGGAGAGAGAGTATGTGG - Intronic
1129240079 15:74245752-74245774 GAGGGTGGGGACAGAGAACGCGG + Intronic
1130374136 15:83312948-83312970 GCAGGTGATGAGAGAGACTGGGG + Intergenic
1131618170 15:94038413-94038435 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1132941226 16:2509272-2509294 GCTTGGGGTGAGCGAGAAGGGGG + Intronic
1135909030 16:26542487-26542509 GGTGGTGGTGACAGAGATGGTGG - Intergenic
1136121787 16:28141377-28141399 GCCGGAAGTGAGAGAGAAAGGGG + Intronic
1136251666 16:29009468-29009490 GCTGCTGCTGAGAGATAACGCGG + Intergenic
1136509625 16:30728944-30728966 CCTGGGGGTGAGAGAAAAAGAGG - Exonic
1136854089 16:33639350-33639372 GATGGTGGTGATAGAGATGGAGG + Intergenic
1137938176 16:52655550-52655572 GCTGCTGGTGAGAGTGAGAGAGG + Intergenic
1138520836 16:57570050-57570072 GCTGCTGGAGATAGAGAAGGTGG - Intronic
1138660250 16:58512332-58512354 ACTGGGGGTGAGGGAGAAGGAGG + Exonic
1139406613 16:66724131-66724153 GATGGTGGTGAGAGTGCACAGGG - Intronic
1140295203 16:73702994-73703016 GATGGTGGTGATAGTGAAAGAGG + Intergenic
1140677986 16:77352641-77352663 GGTGGTGGTGGCAGAGAAGGAGG + Intronic
1140777921 16:78267049-78267071 GCTGGTGGCAAGAGAAAATGAGG - Intronic
1141124911 16:81394410-81394432 GCAGCAGGAGAGAGAGAACGGGG + Intergenic
1141151752 16:81569165-81569187 GGTGATGGGGAGAGAGAACCAGG - Intronic
1141775583 16:86120954-86120976 GCTGGTGGGGAGAAAGAGAGAGG - Intergenic
1142148269 16:88501657-88501679 GCTGGTGATGATAGAGATAGCGG + Intronic
1203115666 16_KI270728v1_random:1487789-1487811 GATGGTGGTGATAGAGATGGAGG + Intergenic
1143735032 17:8905624-8905646 GCTGGAGGTGAGGGAGGAGGGGG - Intronic
1143899442 17:10162834-10162856 GCTGGCGGGGAGAGGGAATGGGG + Intronic
1146537407 17:33664880-33664902 GCTGATGGTGAGATAGCACCAGG - Intronic
1146810579 17:35899822-35899844 TGTGGTGGTGAGAGAGAAGAGGG + Intergenic
1147447583 17:40484213-40484235 TCTGATGGTGGGAGAGAAGGAGG - Intronic
1147864987 17:43546097-43546119 GCGGGTGGTGAGAGTGAGTGTGG + Intronic
1148083838 17:44982358-44982380 GGTGGTGGTGATGGAGAAGGTGG + Intergenic
1148386040 17:47235853-47235875 ACTGGTGGTGAGGGACAACCAGG - Intergenic
1151546761 17:74797995-74798017 GCTGGTGGTGAGAGGCAGTGTGG - Intronic
1151822765 17:76506140-76506162 ACAGGTGGTGAGAGAGAGCAGGG + Intergenic
1152014220 17:77739203-77739225 GCTGGGGCTGAGAGAGAGAGAGG - Intergenic
1152337855 17:79708192-79708214 GCTGGTCCTAAGAGGGAACGGGG - Intergenic
1152467441 17:80474225-80474247 GCCGGTGGGGAGGGAGAAGGTGG - Intronic
1152877484 17:82795334-82795356 CCTGTTGCTGAGAGAGACCGGGG + Intronic
1153059638 18:982012-982034 GCTTGTGGGGAGAGAGAAAGTGG - Intergenic
1153082843 18:1248404-1248426 GCTGGTTGTGAAAAAGAACCTGG - Intergenic
1153199191 18:2632215-2632237 GGTGGTGGCAAGAGAAAACGAGG - Intergenic
1157234419 18:45950462-45950484 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1159703728 18:71661466-71661488 GCTGGTGGAGAGAGAAATGGAGG - Intergenic
1160012511 18:75116680-75116702 GCTGGTGGGGACAGAGACCTCGG + Intergenic
1160242898 18:77135909-77135931 GGTGGTGGAGGGAGAGAAAGAGG + Intergenic
1160399108 18:78596242-78596264 GCTGATGGTGAGACTGAATGAGG + Intergenic
1160467525 18:79094083-79094105 ACTGGTGGTGAAACAGAACTGGG - Intronic
1161294592 19:3513261-3513283 GATGGTGGTGACAGAGCTCGGGG - Intronic
1161302979 19:3551837-3551859 GCTGGAGCAGAGAGAGAAGGGGG - Intronic
1162494981 19:11018489-11018511 CCTGACTGTGAGAGAGAACGAGG - Intronic
1162926618 19:13933412-13933434 GCTGGTTGTGGGAGAGATCCAGG + Exonic
1164409526 19:27989192-27989214 GCAGCTGGTGAAAGAGAAGGTGG - Intergenic
1164441261 19:28282359-28282381 GATGGTGGGAAGAGAGAATGGGG - Intergenic
1164772928 19:30826055-30826077 GCAGGTGGAGAGAGAAAATGAGG - Intergenic
1165066558 19:33232617-33232639 GAAGGTGGGGAGAGAGAAGGAGG - Intergenic
1165116696 19:33533160-33533182 GCTGCTGGTGAGAAAGAAAATGG + Intergenic
1165845532 19:38815726-38815748 GAGGGTGTTGAGAGAGAACGAGG + Intronic
1166562318 19:43741259-43741281 GCTGAGGGTGAGAGAGAAAGAGG + Intronic
1166762182 19:45231880-45231902 GATGGGGGTGAGAGAAAAGGAGG + Intronic
1166799221 19:45445710-45445732 GTGGGTGGACAGAGAGAACGTGG + Intronic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167332945 19:48867626-48867648 GCTGGGGGAGAGAAAGAAAGGGG + Exonic
1167505700 19:49869994-49870016 GCTGGTGCTGCGAGAGGCCGAGG - Exonic
925166793 2:1720538-1720560 GCAGGTGGTGTGAGAAAGCGTGG - Intronic
925335611 2:3097188-3097210 GCTGGTGCTCAGAGAGTAAGAGG - Intergenic
926220122 2:10930677-10930699 GCTTGTGGTGAGGATGAACGGGG + Intergenic
926275003 2:11396900-11396922 GCTGGGGGTGAGGGAGCACAAGG - Intergenic
926343099 2:11921017-11921039 GCTGGAGGTTAGAAAGAAAGAGG - Intergenic
926537063 2:14125934-14125956 GCTGGAGGTCAGAGAGAGGGGGG + Intergenic
929290668 2:40187208-40187230 GCTAGTGGTGAATGAGAACCTGG - Intronic
931465856 2:62486249-62486271 GCTGGAGGTGAGGGAGAACTGGG + Intergenic
933794531 2:85909002-85909024 GGTGGTGGTGAGGGAGTATGTGG - Intergenic
935606926 2:104980860-104980882 GCAGGTAGTGAGAGAGAAAAGGG - Intergenic
936544062 2:113374973-113374995 GGTGGTGGAGAGAGAGAATGAGG + Intergenic
937392320 2:121500277-121500299 GGTGGGGGAGAGAGAGAAAGAGG + Intronic
937547009 2:123035484-123035506 GATGGTGGCAAGAGAGAATGAGG + Intergenic
938590117 2:132728082-132728104 CCTGGTGGTGAGAAAGGAGGAGG - Intronic
938976037 2:136479833-136479855 GCTTGTGGTCAGAGAGGGCGGGG + Intergenic
938992369 2:136642798-136642820 GCTGAGGGAGAGAGAGAACGTGG - Intergenic
939017895 2:136922401-136922423 GGTGGTGGAGAGAGAAAAGGAGG + Intronic
940119116 2:150243109-150243131 GCTGCAGGTGAGAGAGAAGTAGG - Intergenic
940664914 2:156597026-156597048 GCTGGTGGGTAGGGAGAACATGG - Intronic
940810594 2:158238224-158238246 GATGGTGGTGGGAGAGAAATTGG + Intronic
941560156 2:167035012-167035034 GGTGGTGGCAAGAGAGAATGAGG - Intronic
942878177 2:180827558-180827580 GCTGGGGGTGAGAGTGAGGGAGG + Intergenic
944709260 2:202321044-202321066 GATGGTGGTGAGGGAGACAGAGG - Intergenic
946174471 2:217913931-217913953 GCTGGCGGGAAGAGAGAACCAGG - Intronic
946306690 2:218860314-218860336 GCGGGGGGTGGGAGAGAACCCGG - Intronic
947324174 2:228956508-228956530 AGTGGTGGAGAGAGAGAACAGGG - Intronic
948498366 2:238370562-238370584 GCTGGGGGTGGGAGAGCCCGGGG - Intronic
948939085 2:241187352-241187374 GCTGGTGCTGACAGGGAACCCGG + Intergenic
1169063125 20:2675883-2675905 GCTGGTGCTGAGGTTGAACGTGG - Intergenic
1171284493 20:23925948-23925970 TCTGGTGGGGAGGGAGAAGGAGG - Intergenic
1172397351 20:34617957-34617979 GGTGGTGGCAAGAGAGAATGAGG - Intronic
1174268190 20:49347255-49347277 GCAGGTGGAGGGAGAGAAAGTGG - Intergenic
1175646974 20:60683255-60683277 GCTGGTGGCGGGAGAGACAGAGG + Intergenic
1175910135 20:62401321-62401343 GCTGGTGTCAAGGGAGAACGAGG + Intronic
1175959248 20:62626659-62626681 GCTGCTGGTGAAAGTGACCGTGG - Intergenic
1178283505 21:31305536-31305558 GGTGTGGGTGAGAGAGAAGGAGG - Intronic
1179228586 21:39479267-39479289 GCTGGTGGTGATAGTGATGGTGG + Intronic
1179251222 21:39673360-39673382 GCTGGTGGGGAGGGAGCAGGAGG - Intergenic
1179710940 21:43262622-43262644 GGTGGTGGTGGGAGTGAAGGTGG + Intergenic
1179710950 21:43262661-43262683 GGTGGTGGTGGGAGTGAAAGTGG + Intergenic
1179710969 21:43262730-43262752 GGTGGTGGTGGGAGTGAAGGTGG + Intergenic
1179710979 21:43262772-43262794 GGTGGTGGTGGGAGTGAAGGTGG + Intergenic
1182420147 22:30245039-30245061 GCAGGTGGTGAGGGGGAACCAGG - Intronic
1182425776 22:30271286-30271308 TCTGGTGGGGGGAGAGAAGGTGG + Intergenic
1183083766 22:35474120-35474142 GCTGGTGGTGAGAGGGGAGGGGG + Intergenic
1183988729 22:41584058-41584080 ACTGGTGGTGAGGGAGGGCGGGG + Exonic
1184085696 22:42262369-42262391 GAGGGTGGTGAGAGAAAAGGAGG + Intronic
1184587564 22:45458207-45458229 GGTGGTGGTGAGAGAGGAGGAGG + Intergenic
1184727763 22:46356467-46356489 GCAGGTGGTGGGAGGGAACCTGG + Intronic
1185076071 22:48683338-48683360 GCCGGTGGTGAGAGAGCGCCAGG + Intronic
1185286891 22:50005464-50005486 GCTGGTGTTGACAGAGGAGGAGG + Intronic
1185348139 22:50319572-50319594 GCGGGTGGTGAGGGAGATGGAGG - Intronic
950119730 3:10473820-10473842 GCTTGTGATGAGAGAGAATCAGG + Intronic
950271655 3:11620762-11620784 CCTGGGGGTGAGAGGGAAGGAGG - Intronic
950479517 3:13235871-13235893 GCTGGTGGCTACAGGGAACGGGG - Intergenic
950617273 3:14171336-14171358 GCTGGTGTTTTGAGAGAAAGTGG - Intronic
950700540 3:14742789-14742811 GGTGGTGGCAAGAGAAAACGAGG + Intronic
950800898 3:15551182-15551204 GGTGGTGGCAAGAGAAAACGAGG - Intergenic
951088212 3:18539672-18539694 GCTGGTGGTCAAAGAGGAAGAGG + Intergenic
951486748 3:23221455-23221477 GCTGGTGGTGAAAGAGCTGGGGG - Intronic
951575244 3:24106845-24106867 TTTGGTGGTGAAAGAGAAAGGGG + Intergenic
951583898 3:24195707-24195729 GCTGGAGGATAGAGAGAAGGGGG - Intronic
952489313 3:33851182-33851204 GCTGGTAGTGAGAAAGACAGGGG + Intronic
953906159 3:46869186-46869208 GCTGCTGGTGGGAGAGTACAGGG - Intronic
955217029 3:56992710-56992732 GCTGGGGTTGAGAGAGCACCTGG - Intronic
955834779 3:63043028-63043050 CCTGGTGGTGACAGAGAAGGTGG + Intergenic
957807952 3:85175578-85175600 GCTGGTGGGAGGAGAGAATGGGG + Intronic
957901482 3:86499568-86499590 GCTGCAGGAGAGAGAGAGCGAGG + Intergenic
960393077 3:117103341-117103363 GCTGGTAATGAGGGAGAACAAGG + Intronic
960812336 3:121636908-121636930 GAGGGAGGTGAGAGAGAAGGGGG - Intronic
961428589 3:126864465-126864487 GCTGGTGGTGATGGAGGAGGAGG - Intronic
961640502 3:128361840-128361862 GCTGGTGGTGAGAGAGTAGTTGG + Intronic
962304972 3:134278017-134278039 GCTGGTAGTGAGAGCCAACATGG + Intergenic
963945366 3:151140396-151140418 GCTGGTGGAGGGGGAGAAAGGGG - Intronic
964782269 3:160353333-160353355 GCAGGTAGTGAGAGAGATCAGGG + Intronic
964806757 3:160618547-160618569 GTTGGTGTTGACAGAGAAGGAGG + Intergenic
967280956 3:187823076-187823098 GATGGTGGAGAGAAAGAAAGTGG + Intergenic
968956283 4:3721412-3721434 GCTGGGGGTGGGAGGGAACTGGG + Intergenic
970323263 4:14896775-14896797 GCAAGTGCTGAGAGAGAAGGAGG + Intergenic
971359567 4:25924114-25924136 ACTGGTGGTGAGTGTGAACCAGG - Intronic
971508247 4:27390238-27390260 CCTGGTGGAGAGAGAGAATGTGG - Intergenic
971960911 4:33486098-33486120 GGTGGCGGGGAGAGAGAATGGGG + Intergenic
974104844 4:57458258-57458280 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
975257690 4:72256579-72256601 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
975428063 4:74253840-74253862 GCTGGTGGTGAGGTAGACCTGGG - Intronic
976206715 4:82629286-82629308 GCTGCTGGTGAGTGAGAATCAGG + Intergenic
976406625 4:84666589-84666611 GCTGGTGAGGACAGAGAAAGGGG + Intergenic
977736764 4:100426435-100426457 GGTGATAGGGAGAGAGAACGGGG - Intronic
977991071 4:103443017-103443039 CCAGGTGGTTAGATAGAACGGGG + Intergenic
978807805 4:112818715-112818737 GTAGGTGGTGTGAGAGAAAGCGG + Intronic
980467901 4:133209300-133209322 GCTGTTGGTAAGAAAGAATGTGG - Intergenic
980898337 4:138880685-138880707 GCTCGTGGAGAGAGAGAAAGGGG + Intergenic
980928672 4:139164061-139164083 AGTGGGGGTGAGAGAGAAAGAGG + Intronic
981101240 4:140831594-140831616 GGTGGTGGTGAGAGAGAGAGAGG - Intergenic
981241673 4:142483916-142483938 GATGTTGGTGAGAGAGAAGTTGG + Intronic
981819819 4:148873228-148873250 GCTGATGGTGAGAGGAAATGGGG - Intergenic
983542059 4:168921608-168921630 GATGCTGGTGCGTGAGAACGGGG + Exonic
983868770 4:172800106-172800128 GCTGGGGGGGAGAGAGAAATGGG + Intronic
983940899 4:173533118-173533140 GTTGGTGATGAGAGGGAAAGTGG + Intergenic
985565297 5:612382-612404 GCTGGTGCTGAGCGAGGAGGCGG + Exonic
985627638 5:998171-998193 ACTGGTGATCAGAGAGAAAGAGG + Intergenic
986583930 5:9294870-9294892 TCTGGTGGTGGAAGAGAAGGAGG - Intronic
987054482 5:14178532-14178554 GATGGTGTTGAGAGTGAAAGAGG + Intronic
987351356 5:17024992-17025014 GGAGCTGGTGAGAGAGAACCTGG + Intergenic
987965926 5:24872567-24872589 GAAGGTGTTGAGAGAGAAGGTGG - Intergenic
989002045 5:36771226-36771248 TCTGCTGGTGAGAAAGAAGGAGG + Intergenic
991021927 5:61988265-61988287 TTTGGTGGGGAGAGAGGACGAGG - Intergenic
991047785 5:62240827-62240849 GATGGTGGTGATAGAGATGGAGG - Intergenic
991285823 5:64974415-64974437 GGTGGTGGCAAGAGAGAATGAGG + Intronic
991965103 5:72083020-72083042 TCTGAAGGTGAGAGAGAACATGG + Intergenic
992529066 5:77638125-77638147 GATGGTGGGGAGAGAGAAACGGG + Intronic
993632099 5:90299074-90299096 GCTGCTGGTGAGAGAGGTAGGGG + Intergenic
994204827 5:97023062-97023084 GCTGGTGGGGAGAGGGAGTGAGG - Intronic
994247081 5:97489779-97489801 GATGGGGGTTAGAGAGAATGAGG - Intergenic
995190139 5:109311030-109311052 GCTGGGGCTGAGTGAGAACATGG - Intergenic
995468318 5:112474148-112474170 GCGGGTAGAGAGAGAGAATGTGG - Intergenic
998538521 5:142956820-142956842 GGTGGTGGCAAGAGAGAATGAGG + Intronic
1001396803 5:171423579-171423601 TCTTGTGGTGAGAGAGGAAGTGG - Intronic
1001679290 5:173544358-173544380 GCAGGTGGTGAGAGAGGCCAAGG + Intergenic
1001827260 5:174755217-174755239 GCTGGTGGTCATAGAATACGGGG - Intergenic
1003389563 6:5701565-5701587 ACTGTTTGTGAGAGAGAACCTGG - Intronic
1006155492 6:32010939-32010961 GTGGGAGTTGAGAGAGAACGAGG - Intergenic
1006161798 6:32043673-32043695 GTGGGAGTTGAGAGAGAACGAGG - Intronic
1007170057 6:39856464-39856486 GCTGGTGGTCAGTGAGAGGGTGG + Exonic
1007970108 6:46043453-46043475 GCTGGTGGTGAGATAGAGAAAGG + Intronic
1008580579 6:52903227-52903249 GGTGGTGGAGAGGGAGAAGGTGG - Intronic
1008705403 6:54152462-54152484 GGTGGTGGTAAGAGAAAATGAGG + Intronic
1008744276 6:54649930-54649952 GCTGAGGGTGAGAAAGAGCGAGG - Intergenic
1010527097 6:76914657-76914679 GCTGGAGGTAAGAGAGAATAAGG + Intergenic
1010612016 6:77964007-77964029 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1011420870 6:87171276-87171298 GCTGGGGATGAGAGAGAAGCTGG + Intronic
1012297772 6:97546326-97546348 GCTGGGGATGAGAGAGGATGTGG + Intergenic
1012388695 6:98711276-98711298 GCTTGTGGTGTGAAAGAATGTGG - Intergenic
1013405170 6:109836991-109837013 GCAGGGATTGAGAGAGAACGTGG + Intergenic
1015201304 6:130584477-130584499 GTTTGTGATGAGAGAGAGCGGGG + Intergenic
1015603923 6:134936615-134936637 ACTGAGGGTGAGAGAGAATGCGG + Intronic
1015769327 6:136752834-136752856 GCTGGAGGGGAAAGAGAAAGGGG + Intronic
1016000097 6:139033150-139033172 GCTGGAGGTGAGAGAGCAAGGGG + Intronic
1018826783 6:167414011-167414033 GCGAGTGGTGAGTGAGTACGAGG - Intergenic
1018902411 6:168058215-168058237 GCGGATGGAGAGAGAGAACAGGG - Intronic
1018902441 6:168058360-168058382 GCAGATGGAGAGAGAGAACAGGG - Intronic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1019716284 7:2540952-2540974 GGTGGTGGGGATAGAGAGCGAGG - Intronic
1020358828 7:7305343-7305365 GCTGGAGGAGAGAGAGAGAGAGG - Intergenic
1022981434 7:35608549-35608571 GCTGGTAGTGAGAGGAAACGTGG + Intergenic
1023053367 7:36272615-36272637 GCTCGTGGTGGGAGAGCACGTGG + Intronic
1023361005 7:39414931-39414953 GCTTTAGGTGAGAGAGAACTTGG - Intronic
1024208730 7:47185877-47185899 GCTGATGGTGACAGAGAGCAAGG - Intergenic
1025615300 7:63112765-63112787 GCTGGGTGTGAGAGGAAACGGGG + Intergenic
1027833667 7:83214120-83214142 ACTGGTGCTGAGAAAGAAAGTGG + Intergenic
1028774866 7:94664996-94665018 GCTGGTGGTGGGAGCGATGGTGG - Exonic
1030624569 7:111830643-111830665 GCTGGTGGAGAGGGAGAAGCTGG - Intronic
1031317625 7:120275460-120275482 GCTGGTGATGACAGACAATGAGG + Exonic
1034368526 7:150572700-150572722 GCGCGTGGTGAGGGAGAACAAGG + Exonic
1034478648 7:151303406-151303428 GCTGGAGGTGTAAGAGAACCTGG + Intergenic
1034850655 7:154490317-154490339 GCTGATCTTGAGAGAGCACGAGG - Intronic
1035767605 8:2119639-2119661 GCTGGCAGTGAGGGAGAGCGAGG + Intronic
1038459766 8:27705929-27705951 GCTGGTGGTGAGAGAGAGCACGG + Intergenic
1038459769 8:27705987-27706009 GCTGGTGGTGAGAGAGAGCATGG + Intergenic
1039410384 8:37349982-37350004 GTTGGTGGTAAGAGAGCATGTGG - Intergenic
1039973248 8:42338378-42338400 GCAGGTGAGGAGAGAGAACTCGG - Intergenic
1041878467 8:62718039-62718061 GGTGGTGGCAAGAGAGAATGAGG + Intronic
1042606071 8:70548022-70548044 GCTGGTTGTTAAAAAGAACGTGG + Intergenic
1043034483 8:75178908-75178930 GGAGGTGCTGAGAGTGAACGAGG + Intergenic
1043265750 8:78266032-78266054 GGTGGTGGCAAGAGAGAATGAGG - Intergenic
1043988732 8:86725719-86725741 GGTGCTGCTGAGAGAGAAGGCGG + Intronic
1044419643 8:91979611-91979633 GGTGGTGGTGAGAGTGGATGAGG + Intronic
1045151004 8:99408037-99408059 GCTGGTGCAGAGAGAGCACTGGG + Intronic
1045542521 8:103100328-103100350 GGTGGTGGTGACAGAGGATGTGG + Intergenic
1047782421 8:128120838-128120860 GCAGGAGGAGAGAGAGATCGGGG - Intergenic
1048241450 8:132746015-132746037 GATGGGGGAGAGAGAGAAGGGGG + Intronic
1048572362 8:135666659-135666681 GCTGGGGGTAACAGAGAACAGGG - Intergenic
1048818789 8:138360405-138360427 GCTAGTGGTGAGAAAGCAGGAGG - Intronic
1049062244 8:140285646-140285668 CGTGGTGGTAAGAGAGAACATGG - Intronic
1049316126 8:141969330-141969352 CCTGGGGGTGAGGGAGAACCAGG - Intergenic
1049640338 8:143712381-143712403 GCTGGTGGTGACAGCCAAGGGGG + Intronic
1049762985 8:144339178-144339200 GCTGGGGGTGAGGGGGAAGGGGG - Intergenic
1051516540 9:17936416-17936438 TCTGGGGATGAGAGAGAACTTGG - Intergenic
1051609825 9:18950339-18950361 GGTGGTGGTGAAAGGGAACTTGG - Intronic
1054897487 9:70329937-70329959 CATGGCGGTGAGAGAGAAGGGGG + Intronic
1055087595 9:72330004-72330026 GGTGGTGGTGAGAGAAAAGGCGG - Intergenic
1055650085 9:78398581-78398603 GCAGGTGGTGAGAAAGATCTTGG - Intergenic
1055785359 9:79864544-79864566 GCTGGTGGTAACAGAGATCCTGG - Intergenic
1055939271 9:81634310-81634332 GGTGGTGGTGAGAGAGAAAAAGG + Intronic
1056709571 9:88979964-88979986 GCTGGTGGCGAGAGAGAAATGGG - Intergenic
1059994851 9:119898775-119898797 GCTGGTTATGAGAGAGGACCAGG - Intergenic
1060291549 9:122307480-122307502 GCGAGTGGTGAGAGAGAAAATGG - Intronic
1061274611 9:129562216-129562238 GCTGGAGGACAGAGAGAATGGGG - Intergenic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1062207476 9:135345114-135345136 GCTGCTGGTGAGAAAGACGGCGG + Intronic
1187813782 X:23209175-23209197 CCTGGAGGTGAGAGAGAACATGG - Intergenic
1188944078 X:36276309-36276331 ACTGGTAGTGAGAGAGAAAACGG - Intronic
1190331988 X:49241913-49241935 GGTGGTGGTTAGTGAGAAAGTGG + Intronic
1190333911 X:49251420-49251442 GCGGGTGGAGAGCGAGAAGGGGG - Exonic
1190896162 X:54620258-54620280 GGGGGTGGTGAGAGAGAAGTTGG - Intergenic
1192946293 X:75967971-75967993 GCTGGTTGGGAGAGAGAAAAAGG + Intergenic
1194503675 X:94707657-94707679 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1195129904 X:101841391-101841413 GGTGGTGGTGACAGGGAAAGAGG + Intronic
1195176320 X:102318393-102318415 GGTGGTGGTGACAGGGAAAGAGG - Intronic
1195182544 X:102368700-102368722 GGTGGTGGTGACAGGGAAAGAGG + Intronic
1195861823 X:109391271-109391293 GCTGGAGGAGTGAGAGAAGGTGG + Intronic
1196334029 X:114509149-114509171 GTTGGAGGTGAGAGAGTAAGTGG + Intergenic
1196800176 X:119535747-119535769 GGTTGTGGGGAGAGAGAAAGGGG + Intergenic
1197778950 X:130140587-130140609 GCTGGATGTGAGAGACAACATGG - Exonic
1198764533 X:140067281-140067303 GCAGCTGGTTAGAGAGAACGAGG - Intergenic
1198777810 X:140199450-140199472 GGTGGTGGCAAGAGAGAATGAGG + Intergenic
1200003327 X:153072849-153072871 GCTGGGGGTGGGAGTGGACGTGG + Intronic
1200004396 X:153077160-153077182 GCTGGGGGTGGGAGTGGACGTGG - Intergenic
1200070418 X:153526306-153526328 GCTGGTGGTGGGAGGGTAGGGGG + Intronic
1200358775 X:155579670-155579692 GCTAGAGGTGGGAGAGAAAGAGG - Intronic