ID: 913158159

View in Genome Browser
Species Human (GRCh38)
Location 1:116120670-116120692
Sequence CCTACTATGTAGCAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913158159_913158163 28 Left 913158159 1:116120670-116120692 CCTGGCACCTGCTACATAGTAGG 0: 1
1: 1
2: 5
3: 41
4: 275
Right 913158163 1:116120721-116120743 TGTTACAGAAAAGAACATTGAGG 0: 1
1: 1
2: 11
3: 157
4: 1407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913158159 Original CRISPR CCTACTATGTAGCAGGTGCC AGG (reversed) Intronic
901129685 1:6954563-6954585 GCTACTATGTACCAGGTGCAAGG - Intronic
901655015 1:10764334-10764356 CCTACTATGTGCCAGGCGGCAGG + Intronic
901681748 1:10916788-10916810 CCTACTATGTGCCAGGTGCCAGG - Intergenic
902642226 1:17774358-17774380 CCTACTATGTGCCTGGTGCTGGG - Intronic
903152791 1:21424391-21424413 ACGACTATGTAGCACATGCCGGG - Intergenic
903160339 1:21483593-21483615 ACGACTATGTAGCACATGCCGGG + Exonic
904316854 1:29671265-29671287 ACAAATATGTAGCAGGTGTCTGG - Intergenic
904375337 1:30077904-30077926 CCTACTATGAAGCAGAGGCCTGG - Intergenic
904581819 1:31549275-31549297 CCTACTATGTGCTAGGTGCTGGG + Intergenic
905289763 1:36913208-36913230 ATTGCTATGGAGCAGGTGCCCGG - Intronic
905346728 1:37316262-37316284 CCTACTATGTACCAGGCACCGGG - Intergenic
906543092 1:46603254-46603276 CCTACTGTCCAGCATGTGCCTGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907825915 1:58016765-58016787 TGTACTATGTACCAGGTGCAAGG + Intronic
908067980 1:60427960-60427982 CCTACTGTGGACCAGGTGCTGGG - Intergenic
908769051 1:67579870-67579892 CTTACCATGTGGCAGGTGCTTGG - Intergenic
908965589 1:69758138-69758160 CCTACTATGTGCTAGATGCCAGG + Intronic
909163488 1:72185090-72185112 CCTGCCATGTTCCAGGTGCCAGG - Intronic
909270851 1:73621721-73621743 CATACCATGTAGCTGCTGCCAGG + Intergenic
909391024 1:75122254-75122276 CCTACTATGTACCAGGAACTGGG - Intergenic
909638351 1:77843511-77843533 CGTACCATGTGGTAGGTGCCAGG + Intronic
911044866 1:93620005-93620027 CCTACTATGTGTTGGGTGCCAGG - Intronic
911219898 1:95234786-95234808 CCTACTACCTACCAGGTGCCTGG - Intronic
911401487 1:97380238-97380260 CCTACTATGTATAAAGTCCCTGG - Intronic
911712498 1:101090369-101090391 CCTACTATGTACCAGGTCTTGGG - Intergenic
912664025 1:111562932-111562954 CTTACTATGTACCAGGTACTGGG + Intronic
913158159 1:116120670-116120692 CCTACTATGTAGCAGGTGCCAGG - Intronic
913489408 1:119364896-119364918 CCTACTATGTACCAGGCTCTGGG + Intergenic
915375770 1:155393894-155393916 TCTATTATGTACCAGGTGCTGGG + Intronic
915998529 1:160590680-160590702 CAGACTAAGTAGCTGGTGCCTGG + Intergenic
917114805 1:171592048-171592070 CCTACTATATAACATGTGCTTGG + Exonic
919601639 1:199630191-199630213 CCTACTATTTGTCAGGTGCTGGG - Intergenic
920194289 1:204216607-204216629 CTTACTATGTGCCAGGTACCTGG - Intergenic
920313673 1:205063011-205063033 CCCACCATACAGCAGGTGCCCGG + Intronic
920418797 1:205816150-205816172 CCTACTATGTGCCAGGAGCTGGG - Intergenic
922201842 1:223410107-223410129 CCTAGTATGTGTCAAGTGCCTGG - Intergenic
922470132 1:225871615-225871637 CCTACTATGCATCAGGCGCTGGG + Intronic
923683949 1:236141669-236141691 CCAGCGATGTAGCCGGTGCCGGG - Intergenic
1063828554 10:9926126-9926148 CCTACTATGTGACAGGTTCTGGG - Intergenic
1064146171 10:12828149-12828171 CTTAATATGTAGCAGGCACCAGG - Intronic
1066263791 10:33755203-33755225 CATACTGTATACCAGGTGCCAGG + Intergenic
1068009056 10:51425058-51425080 CCTGATACGTAGCAGGGGCCAGG - Intronic
1069628456 10:69882498-69882520 CCTATTATGTGACAGGTGCCTGG - Intronic
1069693624 10:70371376-70371398 CCTGCTGTGTACTAGGTGCCTGG + Intronic
1071505504 10:86229218-86229240 CCCACTCTCTAGCAAGTGCCTGG + Intronic
1072222028 10:93334751-93334773 CCTACTATGTGCCAGGTACTAGG + Intronic
1072612378 10:97026697-97026719 TCTACTATGCACCAGGTCCCAGG - Intronic
1072637632 10:97187798-97187820 CCTACTAAGTGCCAGGTGCTGGG - Intronic
1073083611 10:100874747-100874769 ACTACTAAGGAGCAGGTGCGTGG + Intergenic
1073994194 10:109296395-109296417 CAGACCACGTAGCAGGTGCCTGG + Intergenic
1074711193 10:116178968-116178990 CCAACCAGGTAGCAGGTACCTGG - Intronic
1074811606 10:117110785-117110807 CATACTATGTACCAGGCACCAGG + Intronic
1075934549 10:126328227-126328249 CCTATTATGTGCCAGGTGCTAGG - Intronic
1075945134 10:126426258-126426280 CCTGCTATGCAGCAGGTTCTGGG - Intronic
1076708125 10:132313409-132313431 CCTAGCATGGAGCAGGTGCTTGG - Intronic
1076720620 10:132391046-132391068 CCTGCTGTGTTCCAGGTGCCCGG + Intergenic
1077375822 11:2204700-2204722 CCTACTGTGTGCCAGGTGCCAGG + Intergenic
1078647671 11:13156978-13157000 CCTACTATGTATCAGGCACTAGG - Intergenic
1078806138 11:14706957-14706979 CCTGGTATGTACCAGGTGCTGGG + Intronic
1079755176 11:24250080-24250102 TCTAGTGTGTAGCAGGTGCAGGG + Intergenic
1081533852 11:43983387-43983409 CCTACTATGTGCCTGGTGCAGGG + Intergenic
1083475626 11:62913302-62913324 CCTACTGTTTACCATGTGCCAGG - Intronic
1083581809 11:63829900-63829922 CCTACTATGTGCCAGGCCCCAGG - Intergenic
1083687592 11:64385919-64385941 CCTTCTCTGTACCAGGAGCCAGG + Intergenic
1083718916 11:64594408-64594430 CCTACTATGTGCCAGGTGCTCGG - Intronic
1084491483 11:69480991-69481013 GCAACTGTGTAACAGGTGCCAGG + Intergenic
1086228799 11:84543983-84544005 CCTACTATGGACTAGCTGCCAGG + Intronic
1086745822 11:90425646-90425668 CCTACTAATTAGCAGGTGTAAGG - Intergenic
1088227352 11:107635816-107635838 CCTAGCACATAGCAGGTGCCTGG - Intronic
1089015280 11:115160257-115160279 CCTACTATGTACCAGTTGTGTGG + Intergenic
1089442499 11:118529013-118529035 CCTACTATGTGGCAGTAGGCTGG + Intronic
1089776945 11:120844459-120844481 CCTACTATGTAGGAGGCCACTGG - Intronic
1091686863 12:2568602-2568624 TCTACTTTGTAGCATGTGTCAGG - Intronic
1092476391 12:8822514-8822536 CCTCCTGTGTTCCAGGTGCCAGG + Exonic
1094525749 12:31229560-31229582 CCAACTCTGAAGCAGCTGCCTGG + Intergenic
1096546226 12:52341972-52341994 CCTAGCATGGAGCAGGAGCCAGG + Intergenic
1097176193 12:57144710-57144732 CCTACTATGGGTCAGGTGCCAGG - Intronic
1099508113 12:83503393-83503415 CCTCCTCTGAAGCAGTTGCCAGG + Intergenic
1099601766 12:84748685-84748707 CCTTATGTATAGCAGGTGCCTGG - Intergenic
1101434583 12:104654091-104654113 CCTCCTATGTGCTAGGTGCCGGG + Intronic
1101593979 12:106147475-106147497 CCTACTATATAGCAGGTACTAGG - Intergenic
1102232015 12:111269252-111269274 CCTACTGTGTACCAGGTTCTGGG - Intronic
1103206755 12:119135630-119135652 CCTACTATGCACCAGGTGCTAGG + Intronic
1103366578 12:120388745-120388767 TCTAATATCCAGCAGGTGCCTGG + Intergenic
1103454143 12:121051627-121051649 CCAACTATGTGTCAGGTGCTGGG - Intergenic
1103992639 12:124809587-124809609 CCTACTGTGTGCCAGGTGCCCGG - Intronic
1111840197 13:93440519-93440541 CCTAATACCTAGCAGGTGCCTGG - Intronic
1113676776 13:112213223-112213245 CCTGGAATGGAGCAGGTGCCAGG - Intergenic
1115961104 14:38836937-38836959 CCTACTGTGTAGCGGGCTCCTGG + Intergenic
1117408226 14:55425896-55425918 ACTACCATGTAGCAGATGCTAGG - Intronic
1118455705 14:65944223-65944245 ACTATTATGTAGCAGGGGCGTGG + Intergenic
1118816344 14:69316935-69316957 CCTACTGTGTGCCAGGTGCAGGG + Intronic
1119205648 14:72791666-72791688 ACTACTATGTGGCAGGTTCTGGG + Intronic
1119543892 14:75458021-75458043 CACACTCTGTACCAGGTGCCGGG + Intronic
1119734874 14:76975384-76975406 CCTACTATGTGCCAGGCTCCAGG - Intergenic
1120885224 14:89446724-89446746 CCTACTATGTGCCAGGCACCTGG - Intronic
1124549621 15:30667402-30667424 CTTACTGTGTACCAGGTGCCAGG + Intronic
1125737255 15:41935353-41935375 CCTACTATGTGTCAGGTGCCAGG - Intronic
1126364198 15:47877087-47877109 CATATTATGTAGCAGATTCCTGG - Intergenic
1127303100 15:57677046-57677068 CCTACTATGTGAAAGGCGCCAGG + Intronic
1130768011 15:86892641-86892663 CCTACTGTGTGCCAGGTGCTTGG - Intronic
1131228990 15:90646833-90646855 CCTACTGTGTGCCAGGTGCTGGG - Intergenic
1131450214 15:92533042-92533064 CCAACTCTGTAGCAGCTGCTTGG - Intergenic
1131676560 15:94676051-94676073 CCTTCTAAGTTGCACGTGCCTGG + Intergenic
1134208466 16:12256684-12256706 CCTGCTATGTGCCAGGTACCAGG + Intronic
1134251419 16:12576908-12576930 CCTACTGTATACCAGTTGCCGGG + Intergenic
1134911350 16:18029452-18029474 CCTACTATATATCAAGTGCTAGG + Intergenic
1135190739 16:20352431-20352453 CCTATTATGTGCCAGGTACCAGG - Intronic
1135496536 16:22956553-22956575 CCTACTTTGTATCAGTTCCCAGG - Intergenic
1135664967 16:24328029-24328051 CCTACTATGTGCCAGGTCCTGGG + Intronic
1137625020 16:49902162-49902184 CCTACTATGTTCCAGGTCCTGGG + Intergenic
1137671089 16:50279660-50279682 CCTTCTGTGCACCAGGTGCCAGG - Intronic
1138214418 16:55190847-55190869 CCTACTATGTACCAGGTCCTGGG + Intergenic
1141379558 16:83564175-83564197 CCTTCTGTGTACCAGGTACCAGG + Intronic
1141388310 16:83643545-83643567 ATTACTATGTAGCAGGTGCTGGG - Intronic
1143065937 17:4247338-4247360 TCAAATATGTAGCAGCTGCCTGG + Intronic
1143763907 17:9124956-9124978 GCTAACATGTAGCATGTGCCAGG - Intronic
1144106287 17:11988824-11988846 CTTACTATGTTGCCCGTGCCTGG - Intronic
1144824713 17:18099372-18099394 CCTACCATGTGGCAGGGCCCAGG - Intronic
1147995315 17:44356873-44356895 TCTACTATGTGGCAGGCACCAGG + Intronic
1148120377 17:45206398-45206420 CCTACTGTGTACCAGATGCCAGG + Intergenic
1148678241 17:49457486-49457508 CCTACTATGTGGCAGGCACTGGG + Intronic
1151390735 17:73785218-73785240 CCTACCATGTTGCAGATGCTGGG - Intergenic
1152456742 17:80421380-80421402 CCTCCTATGGACCAGGTCCCAGG + Intronic
1153174689 18:2357642-2357664 ACTGCTATGTGCCAGGTGCCTGG - Intergenic
1154347434 18:13554109-13554131 CCTACTGTGTATCAGGAACCAGG - Intronic
1155354805 18:24941884-24941906 CCTACTATGTGCAAGGTGCTTGG - Intergenic
1155440597 18:25857880-25857902 CCTACTTTGTAGCAGTTGTCTGG - Intergenic
1156004270 18:32421259-32421281 CTTACTGTGTACCAAGTGCCTGG - Intronic
1157395102 18:47334932-47334954 CCTACTATGTATTAGGTCCTGGG - Intergenic
1158391348 18:57047807-57047829 CCTACTGTGTGCCAGGTTCCAGG - Intergenic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1161775324 19:6258927-6258949 CCTACTATGTGCCACGCGCCGGG + Intronic
1162394240 19:10407154-10407176 CCTACTATGTACCAGGTGCCAGG + Intronic
1164876106 19:31691203-31691225 CCTACTAAAGACCAGGTGCCAGG - Intergenic
1166950877 19:46427402-46427424 CCTACTATGTTCCAGGAGCTGGG - Intergenic
926014171 2:9434695-9434717 CCTACTAGGTTGCAAGTCCCAGG + Intronic
926382154 2:12301564-12301586 CCTACTATGTGCTAGGTGCCTGG + Intergenic
926727134 2:16007413-16007435 CCTACTATGTGTCAGGCCCCAGG - Intergenic
928103147 2:28451116-28451138 CCTACTATGTGTCAGGTCCCAGG - Intergenic
928389174 2:30895872-30895894 CCTGTTATATAGCAGGTGTCTGG + Intergenic
928700011 2:33888994-33889016 CCTACTATGTGCCAGGCCCCAGG + Intergenic
929800231 2:45093520-45093542 TCTACTATTAAGCAGCTGCCCGG - Intergenic
930045496 2:47168115-47168137 ATTACTATGTGGCAGGTACCGGG + Intronic
931759588 2:65404920-65404942 CCTGTTAGGGAGCAGGTGCCTGG - Intronic
932122182 2:69112187-69112209 CCTACTCTGCACCAGGTGCTGGG + Intronic
932819203 2:74885293-74885315 CCTACTGTGTAGCAGGTACTGGG - Intronic
934511599 2:94948454-94948476 CCAACTATATAGCAAGTGCTAGG + Intergenic
935405780 2:102707676-102707698 CCTACTGTGTGCCAGATGCCAGG + Intronic
936877908 2:117214576-117214598 CCTACTATGTGTCAGGTACCAGG + Intergenic
936936237 2:117840791-117840813 GCTCCTGTGAAGCAGGTGCCAGG - Intergenic
937914938 2:127094352-127094374 CCTACTATGTGCCAGAAGCCAGG + Intronic
938422109 2:131154218-131154240 CCTGAGATGTAGCAGGGGCCAGG - Intronic
938912365 2:135897723-135897745 CTTCCTATGTGCCAGGTGCCAGG - Intergenic
938935868 2:136126972-136126994 CCTGCTTTCTAGCAGGTCCCAGG + Intergenic
938949486 2:136243753-136243775 CCTGGTATCTAGAAGGTGCCAGG + Intergenic
939901202 2:147851823-147851845 CCTATTGTGTACCAGGTTCCAGG - Intronic
940489450 2:154339080-154339102 CCTAATATGTAGTAGATGCTTGG - Intronic
941734722 2:168960996-168961018 CCTACTATGGAGCTGCTGACAGG - Intronic
943426433 2:187741663-187741685 CCTACTATGTGACAGGCACCAGG - Intergenic
945328469 2:208511520-208511542 ACAAGTATGTAGCATGTGCCAGG + Intronic
946072095 2:217042953-217042975 CCTACTTGGTAGCATGTACCTGG + Intergenic
946250839 2:218411166-218411188 CCTACTATGCACCAGGTTCCTGG + Intergenic
947136653 2:226982789-226982811 CCCACTATGTACCAGGCACCAGG + Intronic
947655058 2:231819825-231819847 CTTACTATGTACTAGGTGCTGGG + Intergenic
1169136307 20:3199909-3199931 CCTTCTAGGTTGGAGGTGCCAGG + Intronic
1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG + Intergenic
1169266422 20:4170015-4170037 CCTACTATGTAGCAGGCCTGGGG - Intronic
1172042651 20:32056875-32056897 CCTACTATGTGCCAGGTGCCAGG - Intronic
1172270735 20:33654440-33654462 CCTGCTTTGTGGCAGGTGCTGGG - Intergenic
1174420927 20:50398841-50398863 CCTACTATGTACCAGGAGTGGGG - Intergenic
1175438923 20:58977105-58977127 CCTACTAGGTGTCAGGTGCTGGG - Intergenic
1177804587 21:25861849-25861871 CCTACTATGTCCCAGGTACTGGG - Intergenic
1178166655 21:29985663-29985685 CCTGCCATGTGGCAGGTTCCAGG - Intergenic
1181821451 22:25478949-25478971 CCTACTATGTGCCAGGTGCAGGG + Intergenic
1181947331 22:26528388-26528410 TCTACTATGTGCCAGGTGCTGGG + Intronic
1181987473 22:26810538-26810560 CCTACTGTGTGCCAAGTGCCAGG - Intergenic
1182021408 22:27084689-27084711 CCTACTATGTACCAGGTGTTGGG - Intergenic
1182117783 22:27767144-27767166 CCTACTATATGTCAGGTGCTAGG - Intronic
1182125965 22:27816034-27816056 CCTACTATGTGCCAGGCACCAGG + Intergenic
1182593903 22:31403306-31403328 CCTACCAGGTAGTAAGTGCCTGG - Intronic
1182681196 22:32081290-32081312 CCTGCTATGTAAGAGGTGCTTGG + Intronic
1182708834 22:32307712-32307734 CTTACTATGTACCAGATGCCAGG - Intergenic
1182774311 22:32819551-32819573 CCTACTATATTCCAGGTGCTGGG + Intronic
1182806725 22:33078388-33078410 CCTACTATGTGCCAGGACCCAGG + Intergenic
1183072489 22:35406242-35406264 ACTACAAAGTGGCAGGTGCCAGG - Intronic
1183099402 22:35574700-35574722 CCTACTATGTGCCAGGTTCTAGG - Intergenic
1183263151 22:36809131-36809153 ACTTGTCTGTAGCAGGTGCCAGG - Intronic
1183419298 22:37701360-37701382 CCCAATATGGAGGAGGTGCCTGG + Exonic
1184094699 22:42310298-42310320 CCTACTATGTGCCAGGTCCTGGG + Intronic
1184368202 22:44066120-44066142 CCTACTGTGTACCAGGTGGGTGG + Intronic
1184925742 22:47635860-47635882 TCTACTATGTGCCAGGTGCTAGG - Intergenic
951926251 3:27911897-27911919 CCTACTATGTATCAGGCACAGGG - Intergenic
952451312 3:33435810-33435832 CATACCATGTATCAGGAGCCTGG + Intronic
952929614 3:38348854-38348876 CCTACTTTGTGCCAGGTGCTAGG + Intronic
953310687 3:41875359-41875381 CTTGCTGTGTACCAGGTGCCAGG - Intronic
953780904 3:45869628-45869650 CCTCCTTTGTGGAAGGTGCCTGG + Intronic
954582436 3:51710348-51710370 CATAGTATGTATCAGGGGCCCGG + Intronic
955487950 3:59453691-59453713 CCTACTATATATTAGGTGCTAGG + Intergenic
955955728 3:64287570-64287592 CCTTCTATGTTCCAGGTGCTGGG - Intronic
956321593 3:68003461-68003483 CCTACTATGTGTTAGGTGCCTGG - Intergenic
956665555 3:71638869-71638891 CCTTCCATATAGCAGGTGGCAGG - Intergenic
957005950 3:74946999-74947021 TCTACTATTTATTAGGTGCCTGG - Intergenic
957217759 3:77343932-77343954 CCTACTATGTGTCAGGTTCCAGG + Intronic
959084911 3:101841966-101841988 CCTACTAAGTAACAGGTACTTGG + Intronic
959297126 3:104550542-104550564 CCTACTATGTGCCAGGTCCAAGG - Intergenic
959580844 3:107980885-107980907 CCTACTATGTGCCAAGTGCTGGG + Intergenic
960194731 3:114751478-114751500 CCTACTATGTGGCACCTGCTAGG + Intronic
961792158 3:129384053-129384075 CCGACTATGAACCAGATGCCTGG - Intergenic
963347837 3:144116943-144116965 CCTACTATGTAGCAGACACTGGG - Intergenic
964209953 3:154215459-154215481 CCTACTATGTTTCAGGTACTAGG - Intronic
964888407 3:161511074-161511096 CCTACTATGTACCAGGCACTAGG + Intergenic
966298213 3:178448716-178448738 CCTACTATGTGCCAGGTACTAGG + Intronic
968231769 3:197008717-197008739 CCCTCTGTGTGGCAGGTGCCTGG - Exonic
968982649 4:3858826-3858848 CCTAGTATACAGCAGGTGCCAGG - Intergenic
968982690 4:3859050-3859072 TCTAGTATACAGCAGGTGCCAGG - Intergenic
968982707 4:3859180-3859202 CCTAGTATACAGCAGGCGCCAGG - Intergenic
968982718 4:3859245-3859267 CCTGGTATATAGCAGGTGCCAGG - Intergenic
968982735 4:3859365-3859387 CCTAGTATACAGCAGGCGCCAGG - Intergenic
968982754 4:3859495-3859517 CCTAGTATACAGCAGGCGCCAGG - Intergenic
968982785 4:3859690-3859712 CCTAGTATACAGCAGGTGCCAGG - Intergenic
970479751 4:16460934-16460956 CTTACTATGTAGTAGGTTCTGGG + Intergenic
971119053 4:23683310-23683332 AGTACTATGTACCATGTGCCAGG - Intergenic
971292376 4:25355995-25356017 CCTACTATGTTCCAGGTATCAGG - Intronic
972705647 4:41539908-41539930 TCTACTATATACCAGGTGCAGGG - Intronic
973547741 4:51998924-51998946 CCTGCTATGTACTAGGTGCTAGG - Intronic
974595730 4:64012671-64012693 CCTCCCATGTGGCGGGTGCCAGG + Intergenic
975314815 4:72939566-72939588 CCTACTACGTATCAGGGGCTAGG + Intergenic
976620676 4:87123990-87124012 CATACTGTCTAGCAGGTGGCAGG - Intronic
981229471 4:142336235-142336257 CCTGCCATGTGGCAGGTTCCAGG - Intronic
983674785 4:170279985-170280007 CCAACTATGTAGCTGGTCCTGGG - Intergenic
983999836 4:174226512-174226534 CCAATTATGAGGCAGGTGCCTGG + Intergenic
985581186 5:696016-696038 CCTCCTATGTGACAGCTGCCTGG - Intergenic
985595810 5:787348-787370 CCTCCTATGTGACAGCTGCCTGG - Intergenic
987434861 5:17882781-17882803 CCTACTCTGTTGGAGGTGGCAGG + Intergenic
990430923 5:55734829-55734851 CCTACTATACACCAGGTACCAGG - Intronic
990670427 5:58123388-58123410 CCTACTATGTGCCTGGTGCTGGG + Intergenic
990843939 5:60115496-60115518 CCTACTATGTACCAGATACAGGG + Intronic
990937658 5:61167250-61167272 CTTAGTATGTACCAGGTGCTGGG + Intergenic
991111417 5:62904077-62904099 CCTAGTATCTAGCAAGTGCTAGG - Intergenic
991248552 5:64533860-64533882 CCTACTATGTACCAGGCACTGGG + Intronic
993538002 5:89111075-89111097 ACTGCTATGTGCCAGGTGCCAGG + Intergenic
994098059 5:95865109-95865131 CCTACTCTGGAGCACTTGCCGGG - Intergenic
996648888 5:125849212-125849234 CCTACTATGTACCAGGTCATAGG + Intergenic
997178403 5:131802516-131802538 CCTACTATGTTCCAAGTGCTAGG + Intergenic
997227480 5:132220049-132220071 CCTACCCTGCAGCAGGTTCCAGG - Intronic
998416614 5:141950829-141950851 CCTACTATGTGTCAGTTGCTGGG + Intronic
998973206 5:147615154-147615176 CCTGCTGTGTACCAGGTGCTGGG - Intronic
999198739 5:149801171-149801193 CTTACTATGTGCCAGGTGCCAGG + Intronic
1001640512 5:173240580-173240602 CCCACTATGTACCAGGTGCTGGG + Intergenic
1003938535 6:11000790-11000812 CTTACCATGTAGCAGGTACTAGG - Intronic
1004130698 6:12916569-12916591 CCTACTCTGTACTAGGTGCTGGG - Intronic
1004194500 6:13490984-13491006 CTGAATATCTAGCAGGTGCCAGG - Intergenic
1006131833 6:31874251-31874273 CCTACTATGTGCCAGGTGCTGGG - Intronic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1006907835 6:37545074-37545096 CCTAGCATCTAGCACGTGCCTGG - Intergenic
1007315797 6:40987780-40987802 TCTACAATGTAGAAGGTGCTTGG - Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007556334 6:42769548-42769570 CCTACTGTGTGCCAAGTGCCGGG + Intronic
1007935102 6:45726006-45726028 CTGGCTATGTAGCAGGTGCTGGG + Intergenic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1013087198 6:106866727-106866749 CCCACTATTTGGCAGGTTCCAGG - Intergenic
1014006883 6:116429349-116429371 CCTACTATGTGGCAGGTGTGGGG - Intronic
1015195116 6:130517164-130517186 CCTACTATGTATCAGGAACAGGG - Intergenic
1015254737 6:131165621-131165643 CCTACTATGTGCCAGGCCCCAGG - Intronic
1016305636 6:142680888-142680910 CCTCCTATGTACCAGATGCTGGG + Intergenic
1017115666 6:150974272-150974294 CTTACCATGTGTCAGGTGCCAGG - Intronic
1019858731 7:3636513-3636535 CATGCTATGTAGCAAATGCCAGG + Intronic
1021370698 7:19842224-19842246 CCTGCTATGTACCAGGTGCTGGG + Intergenic
1021532002 7:21657255-21657277 CCTACTATGCATCAGATGCTAGG + Intronic
1021596985 7:22327950-22327972 CCTGCTATGTAACAAGTGCTTGG + Intronic
1021683015 7:23153851-23153873 TCTAATATGTAGGAGGTGCTAGG + Intronic
1021704164 7:23350655-23350677 CCTTCTATGTAGCAGGGCCCTGG + Intronic
1022021564 7:26404621-26404643 CTTCCTGTGTACCAGGTGCCTGG + Intergenic
1024354467 7:48400279-48400301 CCTAGCAGGTGGCAGGTGCCAGG + Intronic
1024544337 7:50504652-50504674 ACTACTATGGAGCAGAAGCCTGG + Intronic
1025248898 7:57338602-57338624 CCTACTATGTGTCAGGCACCAGG + Intergenic
1026211343 7:68308409-68308431 CCTACTATGTACCAGATGCTTGG - Intergenic
1028889801 7:95974304-95974326 CTTACTATGTGCCAGGTGCTGGG - Intronic
1029672859 7:102045979-102046001 CCTGGGATGTAGTAGGTGCCTGG + Intronic
1029745836 7:102515481-102515503 CCTACTATGGACCCGGTGCCAGG + Intronic
1029763774 7:102614460-102614482 CCTACTATGGACCCGGTGCCAGG + Intronic
1030800451 7:113843765-113843787 CCTACTATGTGTCAGGCCCCAGG + Intergenic
1031026655 7:116686583-116686605 CCTACTATGCATCAGATGCTTGG - Intronic
1033478419 7:141713775-141713797 CCTACTATGTAGCAGATGCTGGG - Intronic
1034425634 7:151012660-151012682 CCTACTATGTACCAGGCACCAGG - Exonic
1034881375 7:154765164-154765186 TCTACTATGTTGCAAATGCCAGG + Intronic
1035198930 7:157247336-157247358 CTTACTAGGTACTAGGTGCCAGG - Intronic
1037836490 8:22217681-22217703 CCTACTATGCACCAGGCACCTGG - Intergenic
1038611640 8:29064539-29064561 CCAACCATGTGGCAGGTCCCAGG + Intronic
1041245160 8:55881864-55881886 CCTACTATGTACCAGGCACTGGG - Intronic
1041631413 8:60092250-60092272 CTAACTATCTAGTAGGTGCCAGG - Intergenic
1042047062 8:64665133-64665155 CCTACTGTGTTACAGGTACCAGG + Intronic
1042105531 8:65322343-65322365 CCTATTATGTGCCAGGAGCCAGG - Intergenic
1042165996 8:65946901-65946923 CCTACAATGTACCAAGTGCTGGG + Intergenic
1043525839 8:81095712-81095734 CCTAGTATGTAGCAGGCACAGGG - Intronic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1046046254 8:108968495-108968517 CCTACTATCTACTATGTGCCAGG - Intergenic
1046189507 8:110774131-110774153 CCTTTTATCTAGCATGTGCCTGG - Intergenic
1046693059 8:117307722-117307744 CCTACAATGTAGCCCTTGCCTGG - Intergenic
1047159843 8:122365762-122365784 ACTACTATGTACTAGGTACCAGG + Intergenic
1047495668 8:125406971-125406993 CCTACTATGTGCCAGGCACCAGG - Intergenic
1047825504 8:128569659-128569681 CCTACTATGTAGCAGGTACTTGG + Intergenic
1049061350 8:140278446-140278468 CCTGCTATGTGCCAGTTGCCTGG - Intronic
1049380966 8:142315579-142315601 CCAGCTCTGAAGCAGGTGCCTGG - Intronic
1050524993 9:6538567-6538589 CCTACTATGTGCCAGGCACCTGG + Intronic
1051916456 9:22214362-22214384 CCTACTATGTACCAGGAAACTGG + Intergenic
1053012012 9:34639026-34639048 ACTAGTAGGTAGCAGGAGCCAGG - Intronic
1054985397 9:71256372-71256394 CCAACTATGTGACAGGTGCGAGG + Intronic
1055281912 9:74683888-74683910 CCTAGTATGTAGCAGGCACTTGG - Intronic
1057520074 9:95752825-95752847 GCTACTATGTAGCCATTGCCTGG - Intergenic
1058612605 9:106791859-106791881 CCTAGGATGTAGCAGGTGTTGGG - Intergenic
1059178844 9:112192874-112192896 CCTCCTATCTAGCAGGTACTTGG + Intergenic
1060516563 9:124269736-124269758 CCTACTATGTGCCAGGCACCGGG - Intronic
1062040876 9:134403752-134403774 CCTACTTTGTGCCAGGAGCCTGG - Intronic
1062048301 9:134434427-134434449 CCTACTATGCGCCAGGTGCAAGG - Intronic
1187353816 X:18547106-18547128 CCTACTATGTAACAGGCACTGGG - Intronic
1187431873 X:19232468-19232490 CCTACTATGTACCAGATACTGGG - Intergenic
1194115543 X:89892293-89892315 CCTACTATGTAACATGCGCTGGG - Intergenic
1195679847 X:107536874-107536896 CCTACTCTGTGCCAGGTGCTGGG - Intronic
1196709979 X:118752683-118752705 CCTACTATATATCAGGCACCAGG - Intronic
1198196103 X:134364140-134364162 CCTACTATGTATCAAGTACATGG - Intergenic