ID: 913174455

View in Genome Browser
Species Human (GRCh38)
Location 1:116261506-116261528
Sequence ATGCTCGGTCCCGCCTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913174455_913174460 20 Left 913174455 1:116261506-116261528 CCTGAGAAGGCGGGACCGAGCAT No data
Right 913174460 1:116261549-116261571 ATGGACCAGAGAAGAGGCTCCGG No data
913174455_913174459 14 Left 913174455 1:116261506-116261528 CCTGAGAAGGCGGGACCGAGCAT No data
Right 913174459 1:116261543-116261565 CTGACAATGGACCAGAGAAGAGG No data
913174455_913174458 1 Left 913174455 1:116261506-116261528 CCTGAGAAGGCGGGACCGAGCAT No data
Right 913174458 1:116261530-116261552 GCTGAGAGCATGACTGACAATGG No data
913174455_913174463 27 Left 913174455 1:116261506-116261528 CCTGAGAAGGCGGGACCGAGCAT No data
Right 913174463 1:116261556-116261578 AGAGAAGAGGCTCCGGCAGGAGG No data
913174455_913174461 24 Left 913174455 1:116261506-116261528 CCTGAGAAGGCGGGACCGAGCAT No data
Right 913174461 1:116261553-116261575 ACCAGAGAAGAGGCTCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913174455 Original CRISPR ATGCTCGGTCCCGCCTTCTC AGG (reversed) Intergenic
No off target data available for this crispr