ID: 913176432

View in Genome Browser
Species Human (GRCh38)
Location 1:116276967-116276989
Sequence CTCACCCCATCCCAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913176427_913176432 12 Left 913176427 1:116276932-116276954 CCTGGCTGCATAGGTGGAGGCCA No data
Right 913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG No data
913176425_913176432 14 Left 913176425 1:116276930-116276952 CCCCTGGCTGCATAGGTGGAGGC No data
Right 913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG No data
913176429_913176432 -8 Left 913176429 1:116276952-116276974 CCAGGTAGACCACTCCTCACCCC No data
Right 913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG No data
913176426_913176432 13 Left 913176426 1:116276931-116276953 CCCTGGCTGCATAGGTGGAGGCC No data
Right 913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913176432 Original CRISPR CTCACCCCATCCCAAAGAAC AGG Intergenic
No off target data available for this crispr