ID: 913177846

View in Genome Browser
Species Human (GRCh38)
Location 1:116291512-116291534
Sequence CTACTTTGTTATTGCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913177846_913177848 7 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177848 1:116291542-116291564 TTTTCCAGTAAAGAGAGACAAGG No data
913177846_913177851 17 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177851 1:116291552-116291574 AAGAGAGACAAGGGAGACTTCGG No data
913177846_913177853 23 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177853 1:116291558-116291580 GACAAGGGAGACTTCGGGCAAGG No data
913177846_913177854 28 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177854 1:116291563-116291585 GGGAGACTTCGGGCAAGGATTGG No data
913177846_913177852 18 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177852 1:116291553-116291575 AGAGAGACAAGGGAGACTTCGGG No data
913177846_913177849 8 Left 913177846 1:116291512-116291534 CCTGCAATGCAATAACAAAGTAG No data
Right 913177849 1:116291543-116291565 TTTCCAGTAAAGAGAGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913177846 Original CRISPR CTACTTTGTTATTGCATTGC AGG (reversed) Intergenic
No off target data available for this crispr