ID: 913178721

View in Genome Browser
Species Human (GRCh38)
Location 1:116298496-116298518
Sequence GGAGGCACAGAGAGTGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913178714_913178721 11 Left 913178714 1:116298462-116298484 CCTCAAGCGCTGCCAGAGTGGAC No data
Right 913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG No data
913178716_913178721 -1 Left 913178716 1:116298474-116298496 CCAGAGTGGACACCGAGGCCAAG No data
Right 913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913178721 Original CRISPR GGAGGCACAGAGAGTGAGCG AGG Intergenic
No off target data available for this crispr