ID: 913179839

View in Genome Browser
Species Human (GRCh38)
Location 1:116310998-116311020
Sequence GAGGCAGAAGTGGGTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913179830_913179839 30 Left 913179830 1:116310945-116310967 CCTTGGCCCCATCACTTTGCTCT No data
Right 913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG No data
913179835_913179839 3 Left 913179835 1:116310972-116310994 CCTCTGTTTCTCATTCTGTAACA No data
Right 913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG No data
913179834_913179839 22 Left 913179834 1:116310953-116310975 CCATCACTTTGCTCTCTGGCCTC No data
Right 913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG No data
913179832_913179839 24 Left 913179832 1:116310951-116310973 CCCCATCACTTTGCTCTCTGGCC No data
Right 913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG No data
913179833_913179839 23 Left 913179833 1:116310952-116310974 CCCATCACTTTGCTCTCTGGCCT No data
Right 913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913179839 Original CRISPR GAGGCAGAAGTGGGTCCATT TGG Intergenic
No off target data available for this crispr