ID: 913180781

View in Genome Browser
Species Human (GRCh38)
Location 1:116319115-116319137
Sequence CAGCCATTCCAGAGCACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913180778_913180781 5 Left 913180778 1:116319087-116319109 CCACCTCTACGCATAGTTATGTT No data
Right 913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG No data
913180779_913180781 2 Left 913180779 1:116319090-116319112 CCTCTACGCATAGTTATGTTACT No data
Right 913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913180781 Original CRISPR CAGCCATTCCAGAGCACAAA TGG Intergenic
No off target data available for this crispr